Incidental Mutation 'R5520:Farp1'
ID431519
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission 043079-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5520 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121235077 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 208 (P208L)
Ref Sequence ENSEMBL: ENSMUSP00000116985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635] [ENSMUST00000135010]
Predicted Effect probably damaging
Transcript: ENSMUST00000026635
AA Change: P208L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: P208L

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135010
AA Change: P208L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116985
Gene: ENSMUSG00000025555
AA Change: P208L

DomainStartEndE-ValueType
B41 36 210 3.4e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153607
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 94.8%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A G 17: 33,065,393 Y812H probably benign Het
4931408C20Rik A T 1: 26,685,819 N93K probably benign Het
AI467606 C T 7: 127,092,826 P191L probably benign Het
Arl9 T C 5: 77,006,593 V56A probably damaging Het
C87499 A C 4: 88,630,040 S43A probably damaging Het
Cacng5 T C 11: 107,877,422 Q253R probably benign Het
Cc2d1b T C 4: 108,626,359 M331T possibly damaging Het
Cep97 A G 16: 55,915,296 S380P probably benign Het
Clpx A T 9: 65,317,448 K153* probably null Het
Dclk2 A G 3: 86,919,840 S111P probably damaging Het
Doxl2 C A 6: 48,975,794 Q218K possibly damaging Het
E2f7 A G 10: 110,759,945 E167G probably damaging Het
Edn1 T C 13: 42,301,960 probably null Het
Fbxw18 G T 9: 109,691,521 H257N probably benign Het
Ftsj3 T C 11: 106,255,588 T22A probably benign Het
Gm17019 A T 5: 15,032,805 M45K possibly damaging Het
Gm438 T A 4: 144,778,024 T186S probably benign Het
Gpr162 T C 6: 124,860,913 D258G probably damaging Het
Grk1 T A 8: 13,409,305 D285E probably benign Het
Herc6 A T 6: 57,647,120 D625V possibly damaging Het
Igkv1-135 C T 6: 67,610,340 P65L possibly damaging Het
Lepr T C 4: 101,745,537 L174P probably benign Het
Nphp3 A G 9: 104,024,673 S689G probably benign Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr301 T A 7: 86,412,856 S165T probably benign Het
Plxnb2 T G 15: 89,167,543 T158P possibly damaging Het
R3hcc1 T A 14: 69,698,608 K437* probably null Het
Rnf213 C A 11: 119,433,499 H1428Q probably damaging Het
Ssx2ip G A 3: 146,437,311 R548H probably benign Het
Trim23 C T 13: 104,187,527 R165C probably damaging Het
Trove2 A T 1: 143,770,771 S79T probably benign Het
Ulk2 T G 11: 61,808,144 T405P probably damaging Het
Unkl G A 17: 25,205,610 V204I probably damaging Het
Vmn1r43 T C 6: 89,869,746 T253A probably damaging Het
Zfp534 T C 4: 147,675,430 I261V possibly damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGGTAATAGGGCTTTTGTCC -3'
(R):5'- AGATCCACTAGAGGCCTTAGC -3'

Sequencing Primer
(F):5'- GTCCTCGCTGTGTGGCTC -3'
(R):5'- CCCACCCATGTTAACCTGG -3'
Posted On2016-10-05