Incidental Mutation 'R5521:Cenpe'
ID 431533
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 043080-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5521 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 135212537-135273611 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135269065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2329 (S2329P)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062893
AA Change: S2329P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: S2329P

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199497
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.5%
  • 10x: 94.4%
  • 20x: 87.5%
Validation Efficiency 94% (72/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,279,683 probably benign Het
Abhd14a G T 9: 106,443,834 D107E probably damaging Het
Acat1 T A 9: 53,583,507 K362* probably null Het
Adad2 T A 8: 119,612,789 S3R probably benign Het
Adcy8 C A 15: 64,815,350 R435M probably damaging Het
Adgrv1 A T 13: 81,419,389 S5222T probably benign Het
Ankk1 A T 9: 49,420,448 M182K probably benign Het
Apba1 C T 19: 23,893,593 P263L probably damaging Het
Arhgap39 G A 15: 76,765,494 S26L possibly damaging Het
Ccng1 G A 11: 40,752,266 T118I possibly damaging Het
Chil4 A G 3: 106,203,697 Y294H possibly damaging Het
Chst8 A C 7: 34,675,245 S390A probably benign Het
Dars T C 1: 128,373,973 D308G probably benign Het
Dlec1 A C 9: 119,143,401 Q1458P possibly damaging Het
Dvl2 G A 11: 70,006,407 E312K probably damaging Het
Fchsd1 T C 18: 37,966,484 H219R probably damaging Het
Foxd4 A C 19: 24,899,643 C398G probably damaging Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Gm5414 T C 15: 101,627,987 I68V probably benign Het
Gmip C T 8: 69,817,399 T684I probably damaging Het
Gpr137c T C 14: 45,278,694 I295T possibly damaging Het
Hivep1 T A 13: 42,158,328 M1348K probably damaging Het
Igkv6-23 T C 6: 70,260,613 D48G probably benign Het
Il3 G A 11: 54,267,132 T40M possibly damaging Het
Ing2 T C 8: 47,669,213 E100G probably damaging Het
Itpr3 C A 17: 27,107,334 H1359Q probably benign Het
Lama1 T A 17: 67,780,894 Y1502* probably null Het
Mamdc2 C A 19: 23,310,938 G579W probably damaging Het
Mapk6 G A 9: 75,393,316 probably benign Het
Mapk8ip2 C T 15: 89,458,804 R616W probably damaging Het
Mc5r T A 18: 68,339,677 L369H possibly damaging Het
Meis1 T C 11: 18,988,260 probably benign Het
Mmp8 A G 9: 7,560,643 K107R probably benign Het
Mn1 C T 5: 111,421,769 H1202Y possibly damaging Het
Naip2 A G 13: 100,154,914 L1172P probably damaging Het
Nek9 C T 12: 85,327,445 D273N probably benign Het
Nlrp4e A T 7: 23,321,765 D559V probably benign Het
Nlrp4g T C 9: 124,350,020 noncoding transcript Het
Oit3 G T 10: 59,435,914 A207E probably benign Het
Olfr1140 A G 2: 87,747,062 I289V probably benign Het
Olfr298 A T 7: 86,488,631 C307S probably benign Het
Olfr462 A T 11: 87,889,719 M59K probably damaging Het
Olfr71 A T 4: 43,705,788 M260K possibly damaging Het
Pde4c T C 8: 70,747,382 probably null Het
Ppp1r26 A G 2: 28,451,426 E356G probably benign Het
Pramef12 A G 4: 144,395,971 M1T probably null Het
Ptges3-ps T A 6: 85,844,321 noncoding transcript Het
Ptpn13 T G 5: 103,501,428 F232L probably benign Het
Reps1 T C 10: 18,104,234 S114P probably damaging Het
Scarf2 T A 16: 17,803,602 probably null Het
Sdha A T 13: 74,350,099 probably benign Het
Secisbp2l A T 2: 125,752,977 V146D possibly damaging Het
Slc26a8 T A 17: 28,654,859 T385S probably benign Het
Slc4a1 G A 11: 102,353,266 T679M probably benign Het
Tbc1d14 T A 5: 36,520,552 E353V probably damaging Het
Thap2 T A 10: 115,372,760 K152* probably null Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
V1ra8 T A 6: 90,203,054 W80R probably damaging Het
Vmn1r218 A G 13: 23,136,573 Y30C probably benign Het
Vmn2r60 C A 7: 42,195,625 T804K probably damaging Het
Vmn2r68 A T 7: 85,233,718 D275E probably benign Het
Vps13c A G 9: 67,951,439 I2724V probably benign Het
Xrcc5 C A 1: 72,346,271 P507Q probably damaging Het
Zfp120 A T 2: 150,117,579 Y274* probably null Het
Zfp780b C A 7: 27,974,748 probably null Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7973:Cenpe UTSW 3 135223250 missense probably damaging 1.00
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8191:Cenpe UTSW 3 135251614 missense probably benign
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
R8425:Cenpe UTSW 3 135242627 nonsense probably null
R8488:Cenpe UTSW 3 135259241 missense probably damaging 1.00
R8811:Cenpe UTSW 3 135223240 missense probably damaging 1.00
R8850:Cenpe UTSW 3 135225016 missense probably damaging 1.00
R8879:Cenpe UTSW 3 135260101 missense probably damaging 0.99
R8899:Cenpe UTSW 3 135239883 missense probably benign 0.18
R9035:Cenpe UTSW 3 135270811 missense probably benign 0.01
R9038:Cenpe UTSW 3 135218036 missense probably benign 0.00
R9093:Cenpe UTSW 3 135239880 nonsense probably null
R9221:Cenpe UTSW 3 135230078 missense possibly damaging 0.90
R9365:Cenpe UTSW 3 135248446 missense possibly damaging 0.56
R9443:Cenpe UTSW 3 135270848 missense probably damaging 0.99
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGAGCTAGTTAAGGTTATCTGCCTG -3'
(R):5'- CGTCATGCAGTCAGAACTTTC -3'

Sequencing Primer
(F):5'- GTACCAGATCAAGAGTCAGCCTG -3'
(R):5'- AGTTCTATCTATTAGGTATCTCTGGC -3'
Posted On 2016-10-05