Incidental Mutation 'R5521:Olfr71'
ID431535
Institutional Source Beutler Lab
Gene Symbol Olfr71
Ensembl Gene ENSMUSG00000046450
Gene Nameolfactory receptor 71
SynonymsGA_x6K02T2N78B-16230286-16231224, mOR17, MOR262-4
MMRRC Submission 043080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5521 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43704562-43710255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43705788 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 260 (M260K)
Ref Sequence ENSEMBL: ENSMUSP00000149725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055401] [ENSMUST00000055545] [ENSMUST00000107862] [ENSMUST00000217544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055401
AA Change: M260K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060230
Gene: ENSMUSG00000046450
AA Change: M260K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-34 PFAM
Pfam:7tm_4 139 283 4.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055545
SMART Domains Protein: ENSMUSP00000060748
Gene: ENSMUSG00000050215

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 9.6e-51 PFAM
Pfam:7tm_1 41 289 3.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107862
AA Change: M260K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103494
Gene: ENSMUSG00000046450
AA Change: M260K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-52 PFAM
Pfam:7tm_1 41 290 7.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217544
AA Change: M260K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.5%
  • 10x: 94.4%
  • 20x: 87.5%
Validation Efficiency 94% (72/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A G 9: 44,279,683 probably benign Het
Abhd14a G T 9: 106,443,834 D107E probably damaging Het
Acat1 T A 9: 53,583,507 K362* probably null Het
Adad2 T A 8: 119,612,789 S3R probably benign Het
Adcy8 C A 15: 64,815,350 R435M probably damaging Het
Adgrv1 A T 13: 81,419,389 S5222T probably benign Het
Ankk1 A T 9: 49,420,448 M182K probably benign Het
Apba1 C T 19: 23,893,593 P263L probably damaging Het
Arhgap39 G A 15: 76,765,494 S26L possibly damaging Het
Ccng1 G A 11: 40,752,266 T118I possibly damaging Het
Cenpe T C 3: 135,269,065 S2329P probably damaging Het
Chil4 A G 3: 106,203,697 Y294H possibly damaging Het
Chst8 A C 7: 34,675,245 S390A probably benign Het
Dars T C 1: 128,373,973 D308G probably benign Het
Dlec1 A C 9: 119,143,401 Q1458P possibly damaging Het
Dvl2 G A 11: 70,006,407 E312K probably damaging Het
Fchsd1 T C 18: 37,966,484 H219R probably damaging Het
Foxd4 A C 19: 24,899,643 C398G probably damaging Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Gm5414 T C 15: 101,627,987 I68V probably benign Het
Gmip C T 8: 69,817,399 T684I probably damaging Het
Gpr137c T C 14: 45,278,694 I295T possibly damaging Het
Hivep1 T A 13: 42,158,328 M1348K probably damaging Het
Igkv6-23 T C 6: 70,260,613 D48G probably benign Het
Il3 G A 11: 54,267,132 T40M possibly damaging Het
Ing2 T C 8: 47,669,213 E100G probably damaging Het
Itpr3 C A 17: 27,107,334 H1359Q probably benign Het
Lama1 T A 17: 67,780,894 Y1502* probably null Het
Mamdc2 C A 19: 23,310,938 G579W probably damaging Het
Mapk6 G A 9: 75,393,316 probably benign Het
Mapk8ip2 C T 15: 89,458,804 R616W probably damaging Het
Mc5r T A 18: 68,339,677 L369H possibly damaging Het
Meis1 T C 11: 18,988,260 probably benign Het
Mmp8 A G 9: 7,560,643 K107R probably benign Het
Mn1 C T 5: 111,421,769 H1202Y possibly damaging Het
Naip2 A G 13: 100,154,914 L1172P probably damaging Het
Nek9 C T 12: 85,327,445 D273N probably benign Het
Nlrp4e A T 7: 23,321,765 D559V probably benign Het
Nlrp4g T C 9: 124,350,020 noncoding transcript Het
Oit3 G T 10: 59,435,914 A207E probably benign Het
Olfr1140 A G 2: 87,747,062 I289V probably benign Het
Olfr298 A T 7: 86,488,631 C307S probably benign Het
Olfr462 A T 11: 87,889,719 M59K probably damaging Het
Pde4c T C 8: 70,747,382 probably null Het
Ppp1r26 A G 2: 28,451,426 E356G probably benign Het
Pramef12 A G 4: 144,395,971 M1T probably null Het
Ptges3-ps T A 6: 85,844,321 noncoding transcript Het
Ptpn13 T G 5: 103,501,428 F232L probably benign Het
Reps1 T C 10: 18,104,234 S114P probably damaging Het
Scarf2 T A 16: 17,803,602 probably null Het
Sdha A T 13: 74,350,099 probably benign Het
Secisbp2l A T 2: 125,752,977 V146D possibly damaging Het
Slc26a8 T A 17: 28,654,859 T385S probably benign Het
Slc4a1 G A 11: 102,353,266 T679M probably benign Het
Tbc1d14 T A 5: 36,520,552 E353V probably damaging Het
Thap2 T A 10: 115,372,760 K152* probably null Het
Thbd A T 2: 148,407,735 I71N probably damaging Het
V1ra8 T A 6: 90,203,054 W80R probably damaging Het
Vmn1r218 A G 13: 23,136,573 Y30C probably benign Het
Vmn2r60 C A 7: 42,195,625 T804K probably damaging Het
Vmn2r68 A T 7: 85,233,718 D275E probably benign Het
Vps13c A G 9: 67,951,439 I2724V probably benign Het
Xrcc5 C A 1: 72,346,271 P507Q probably damaging Het
Zfp120 A T 2: 150,117,579 Y274* probably null Het
Zfp780b C A 7: 27,974,748 probably null Het
Other mutations in Olfr71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Olfr71 APN 4 43706172 missense probably damaging 1.00
PIT4453001:Olfr71 UTSW 4 43706464 missense probably damaging 1.00
R0597:Olfr71 UTSW 4 43706592 unclassified probably null
R0610:Olfr71 UTSW 4 43706400 missense possibly damaging 0.69
R1588:Olfr71 UTSW 4 43705923 missense probably damaging 0.98
R1619:Olfr71 UTSW 4 43706292 missense probably damaging 1.00
R1779:Olfr71 UTSW 4 43706041 missense probably damaging 1.00
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R4723:Olfr71 UTSW 4 43705785 missense probably damaging 1.00
R4891:Olfr71 UTSW 4 43706194 missense probably damaging 0.99
R5049:Olfr71 UTSW 4 43706259 missense probably damaging 1.00
R5151:Olfr71 UTSW 4 43706518 missense probably damaging 0.99
R5491:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
R6225:Olfr71 UTSW 4 43705698 missense probably damaging 1.00
R6518:Olfr71 UTSW 4 43706334 missense probably benign 0.05
R6883:Olfr71 UTSW 4 43705723 missense possibly damaging 0.93
R7185:Olfr71 UTSW 4 43706082 missense possibly damaging 0.82
R7339:Olfr71 UTSW 4 43706080 missense probably benign 0.05
R7502:Olfr71 UTSW 4 43706316 missense probably damaging 0.97
R8052:Olfr71 UTSW 4 43705884 missense probably damaging 0.97
X0017:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
X0021:Olfr71 UTSW 4 43706326 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTGATCCACATAACAAGGG -3'
(R):5'- TGACACCTCAGTCAGCGATG -3'

Sequencing Primer
(F):5'- TACCCATGCAGAGCCCTG -3'
(R):5'- AGTCAGCGATGCCTTCCTG -3'
Posted On2016-10-05