Mutagenetix > Incidental Mutations

Incidental Mutation 'R5521:Mn1'

431539

Institutional Source

Beutler Lab

Gene Symbol

Mn1

Ensembl Gene

ENSMUSG00000070576

Gene Name

meningioma 1

Synonyms

MMRRC Submission

043080-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111417362-111457033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 111421769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 1202 (H1202Y)

Ref Sequence

ENSEMBL: ENSMUSP00000092034 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094463]

AlphaFold

D3YWE6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094463
AA Change: H1202Y

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576
AA Change: H1202Y

Domain	Start	End	E-Value	Type
low complexity region	92	124	N/A	INTRINSIC
low complexity region	128	144	N/A	INTRINSIC
low complexity region	201	217	N/A	INTRINSIC
low complexity region	291	303	N/A	INTRINSIC
low complexity region	333	354	N/A	INTRINSIC
coiled coil region	507	548	N/A	INTRINSIC
low complexity region	551	565	N/A	INTRINSIC
low complexity region	569	584	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
low complexity region	708	725	N/A	INTRINSIC
low complexity region	727	738	N/A	INTRINSIC
low complexity region	745	771	N/A	INTRINSIC
low complexity region	780	791	N/A	INTRINSIC
low complexity region	862	892	N/A	INTRINSIC
low complexity region	913	933	N/A	INTRINSIC
low complexity region	957	972	N/A	INTRINSIC
low complexity region	1098	1110	N/A	INTRINSIC
low complexity region	1134	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138784

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196957

Meta Mutation Damage Score

0.1710

Coding Region Coverage

1x: 99.1%
3x: 97.5%
10x: 94.4%
20x: 87.5%

Validation Efficiency

94% (72/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	A	G	9: 44,279,683		probably benign	Het
Abhd14a	G	T	9: 106,443,834	D107E	probably damaging	Het
Acat1	T	A	9: 53,583,507	K362*	probably null	Het
Adad2	T	A	8: 119,612,789	S3R	probably benign	Het
Adcy8	C	A	15: 64,815,350	R435M	probably damaging	Het
Adgrv1	A	T	13: 81,419,389	S5222T	probably benign	Het
Ankk1	A	T	9: 49,420,448	M182K	probably benign	Het
Apba1	C	T	19: 23,893,593	P263L	probably damaging	Het
Arhgap39	G	A	15: 76,765,494	S26L	possibly damaging	Het
Ccng1	G	A	11: 40,752,266	T118I	possibly damaging	Het
Cenpe	T	C	3: 135,269,065	S2329P	probably damaging	Het
Chil4	A	G	3: 106,203,697	Y294H	possibly damaging	Het
Chst8	A	C	7: 34,675,245	S390A	probably benign	Het
Dars	T	C	1: 128,373,973	D308G	probably benign	Het
Dlec1	A	C	9: 119,143,401	Q1458P	possibly damaging	Het
Dvl2	G	A	11: 70,006,407	E312K	probably damaging	Het
Fchsd1	T	C	18: 37,966,484	H219R	probably damaging	Het
Foxd4	A	C	19: 24,899,643	C398G	probably damaging	Het
Gm10719	T	A	9: 3,018,970	F72I	probably damaging	Het
Gm5414	T	C	15: 101,627,987	I68V	probably benign	Het
Gmip	C	T	8: 69,817,399	T684I	probably damaging	Het
Gpr137c	T	C	14: 45,278,694	I295T	possibly damaging	Het
Hivep1	T	A	13: 42,158,328	M1348K	probably damaging	Het
Igkv6-23	T	C	6: 70,260,613	D48G	probably benign	Het
Il3	G	A	11: 54,267,132	T40M	possibly damaging	Het
Ing2	T	C	8: 47,669,213	E100G	probably damaging	Het
Itpr3	C	A	17: 27,107,334	H1359Q	probably benign	Het
Lama1	T	A	17: 67,780,894	Y1502*	probably null	Het
Mamdc2	C	A	19: 23,310,938	G579W	probably damaging	Het
Mapk6	G	A	9: 75,393,316		probably benign	Het
Mapk8ip2	C	T	15: 89,458,804	R616W	probably damaging	Het
Mc5r	T	A	18: 68,339,677	L369H	possibly damaging	Het
Meis1	T	C	11: 18,988,260		probably benign	Het
Mmp8	A	G	9: 7,560,643	K107R	probably benign	Het
Naip2	A	G	13: 100,154,914	L1172P	probably damaging	Het
Nek9	C	T	12: 85,327,445	D273N	probably benign	Het
Nlrp4e	A	T	7: 23,321,765	D559V	probably benign	Het
Nlrp4g	T	C	9: 124,350,020		noncoding transcript	Het
Oit3	G	T	10: 59,435,914	A207E	probably benign	Het
Olfr1140	A	G	2: 87,747,062	I289V	probably benign	Het
Olfr298	A	T	7: 86,488,631	C307S	probably benign	Het
Olfr462	A	T	11: 87,889,719	M59K	probably damaging	Het
Olfr71	A	T	4: 43,705,788	M260K	possibly damaging	Het
Pde4c	T	C	8: 70,747,382		probably null	Het
Ppp1r26	A	G	2: 28,451,426	E356G	probably benign	Het
Pramef12	A	G	4: 144,395,971	M1T	probably null	Het
Ptges3-ps	T	A	6: 85,844,321		noncoding transcript	Het
Ptpn13	T	G	5: 103,501,428	F232L	probably benign	Het
Reps1	T	C	10: 18,104,234	S114P	probably damaging	Het
Scarf2	T	A	16: 17,803,602		probably null	Het
Sdha	A	T	13: 74,350,099		probably benign	Het
Secisbp2l	A	T	2: 125,752,977	V146D	possibly damaging	Het
Slc26a8	T	A	17: 28,654,859	T385S	probably benign	Het
Slc4a1	G	A	11: 102,353,266	T679M	probably benign	Het
Tbc1d14	T	A	5: 36,520,552	E353V	probably damaging	Het
Thap2	T	A	10: 115,372,760	K152*	probably null	Het
Thbd	A	T	2: 148,407,735	I71N	probably damaging	Het
V1ra8	T	A	6: 90,203,054	W80R	probably damaging	Het
Vmn1r218	A	G	13: 23,136,573	Y30C	probably benign	Het
Vmn2r60	C	A	7: 42,195,625	T804K	probably damaging	Het
Vmn2r68	A	T	7: 85,233,718	D275E	probably benign	Het
Vps13c	A	G	9: 67,951,439	I2724V	probably benign	Het
Xrcc5	C	A	1: 72,346,271	P507Q	probably damaging	Het
Zfp120	A	T	2: 150,117,579	Y274*	probably null	Het
Zfp780b	C	A	7: 27,974,748		probably null	Het

Other mutations in Mn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Mn1	APN	5	111421547	missense	possibly damaging	0.85
IGL01139:Mn1	APN	5	111421449	missense	probably damaging	0.96
IGL01546:Mn1	APN	5	111421248	missense	probably damaging	1.00
IGL02252:Mn1	APN	5	111421241	missense	probably damaging	0.96
IGL02821:Mn1	APN	5	111421851	missense	probably damaging	0.99
IGL03203:Mn1	APN	5	111421403	missense	probably benign
Uebermus	UTSW	5	111421886	splice site	probably null
FR4342:Mn1	UTSW	5	111419706	small insertion	probably benign
FR4449:Mn1	UTSW	5	111419710	small insertion	probably benign
FR4548:Mn1	UTSW	5	111419698	small insertion	probably benign
FR4976:Mn1	UTSW	5	111419702	small insertion	probably benign
R0639:Mn1	UTSW	5	111419316	missense	probably damaging	1.00
R0676:Mn1	UTSW	5	111421034	missense	possibly damaging	0.52
R1537:Mn1	UTSW	5	111454780	missense	probably damaging	0.96
R1638:Mn1	UTSW	5	111421569	missense	probably damaging	1.00
R1739:Mn1	UTSW	5	111420014	missense	possibly damaging	0.92
R1922:Mn1	UTSW	5	111418746	missense	probably damaging	0.99
R2008:Mn1	UTSW	5	111418857	missense	probably damaging	1.00
R2104:Mn1	UTSW	5	111454751	missense	possibly damaging	0.72
R2519:Mn1	UTSW	5	111418552	missense	possibly damaging	0.85
R3980:Mn1	UTSW	5	111421770	missense	possibly damaging	0.85
R4008:Mn1	UTSW	5	111420169	missense	probably benign
R4564:Mn1	UTSW	5	111420667	missense	possibly damaging	0.93
R4647:Mn1	UTSW	5	111420083	missense	probably benign
R4779:Mn1	UTSW	5	111419660	missense	probably damaging	0.99
R4819:Mn1	UTSW	5	111419937	missense	possibly damaging	0.93
R4962:Mn1	UTSW	5	111454786	missense	possibly damaging	0.85
R5373:Mn1	UTSW	5	111421886	splice site	probably null
R5374:Mn1	UTSW	5	111421886	splice site	probably null
R5633:Mn1	UTSW	5	111420326	missense	possibly damaging	0.52
R5744:Mn1	UTSW	5	111420536	missense	possibly damaging	0.93
R6050:Mn1	UTSW	5	111419397	missense	probably damaging	1.00
R6552:Mn1	UTSW	5	111420887	missense	possibly damaging	0.93
R7206:Mn1	UTSW	5	111420512	missense	possibly damaging	0.85
R7244:Mn1	UTSW	5	111418833	missense	possibly damaging	0.78
R8207:Mn1	UTSW	5	111421785	missense	probably damaging	0.99
R8222:Mn1	UTSW	5	111418680	missense	probably damaging	1.00
R8353:Mn1	UTSW	5	111420639	missense	possibly damaging	0.85
R8677:Mn1	UTSW	5	111419019	nonsense	probably null
R8990:Mn1	UTSW	5	111418515	missense	possibly damaging	0.85
RF025:Mn1	UTSW	5	111419705	nonsense	probably null
RF027:Mn1	UTSW	5	111419705	small insertion	probably benign
RF028:Mn1	UTSW	5	111419711	small insertion	probably benign
RF032:Mn1	UTSW	5	111419711	small insertion	probably benign
RF040:Mn1	UTSW	5	111419705	small insertion	probably benign
Z1088:Mn1	UTSW	5	111418280	missense	possibly damaging	0.85
Z1176:Mn1	UTSW	5	111420379	missense	probably benign	0.08
Z1176:Mn1	UTSW	5	111454706	missense	possibly damaging	0.93
Z1177:Mn1	UTSW	5	111420068	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGAGACAACAATTTAGCATCTC -3'
(R):5'- TACCTGACAGCCCAACAGTG -3'

Sequencing Primer
(F):5'- ATTTAGCATCTCGGAGGACCAGC -3'
(R):5'- TGTGCAACCAGAGAGTCTG -3'

Posted On

2016-10-05