Mutagenetix > Incidental Mutation

Incidental Mutation 'R0469:Gucy2e'

43158

Institutional Source

Beutler Lab

Gene Symbol

Gucy2e

Ensembl Gene

ENSMUSG00000020890

Gene Name

guanylate cyclase 2e

Synonyms

GC1, GC-E, ROS-GC1

MMRRC Submission

038669-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R0469 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

69218117-69237036 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69235576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 326 (D326G)

Ref Sequence

ENSEMBL: ENSMUSP00000104305 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]

AlphaFold

P52785

Predicted Effect

probably benign
Transcript: ENSMUST00000021259
AA Change: D326G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: D326G

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108664
AA Change: D326G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: D326G

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	2.4e-40	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	560	807	9.5e-23	PFAM
Pfam:Pkinase_Tyr	560	807	7.7e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108665
AA Change: D326G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: D326G

Domain	Start	End	E-Value	Type
low complexity region	5	15	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:ANF_receptor	75	403	5.3e-37	PFAM
transmembrane domain	468	490	N/A	INTRINSIC
Pfam:Pkinase	557	807	1.1e-24	PFAM
Pfam:Pkinase_Tyr	560	807	2e-29	PFAM
CYCc	847	1050	7.78e-104	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155457

Meta Mutation Damage Score

0.0767

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Acoxl	G	A	2: 127,880,503		probably null	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Arih2	T	A	9: 108,605,092	H490L	possibly damaging	Het
Arpc1b	T	A	5: 145,127,715	W361R	probably damaging	Het
B3gntl1	A	T	11: 121,673,025	V3D	probably benign	Het
Baiap2l1	T	C	5: 144,275,891	Y438C	probably damaging	Het
Bicc1	C	A	10: 71,079,215	R73L	probably benign	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cep76	A	T	18: 67,634,780	N227K	probably benign	Het
Col6a4	A	T	9: 106,080,547	V26D	probably damaging	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Cpsf2	T	C	12: 101,988,786	V272A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dnah12	A	G	14: 26,798,899	R1892G	probably damaging	Het
Efr3b	G	T	12: 3,982,058	D183E	probably benign	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Ggn	C	T	7: 29,171,296	P47S	probably damaging	Het
Gli3	T	G	13: 15,724,785	L919R	probably damaging	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Golgb1	A	G	16: 36,931,635	I3144V	probably benign	Het
Gpr108	T	C	17: 57,235,358	D549G	possibly damaging	Het
Gpr39	C	T	1: 125,677,500	T55M	probably damaging	Het
Grk4	A	G	5: 34,716,213	T208A	probably damaging	Het
H2-Eb2	C	T	17: 34,334,244	Q135*	probably null	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Hnrnph3	T	A	10: 63,018,215	R41S	probably benign	Het
Hnrnph3	T	A	10: 63,019,500	D2V	probably damaging	Het
Hs3st2	T	C	7: 121,500,569	S213P	probably damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Kctd21	T	C	7: 97,347,541	F74L	probably damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Lmtk3	T	A	7: 45,794,112	L740M	possibly damaging	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Naca	C	T	10: 128,044,790	A1897V	probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr338	A	T	2: 36,377,462	I229F	probably benign	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pkn1	C	A	8: 83,672,324	C678F	probably damaging	Het
Pla2g4a	T	A	1: 149,840,647	M688L	possibly damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Psen2	T	C	1: 180,238,914	T153A	probably damaging	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Rbp3	A	G	14: 33,962,419	K1135R	possibly damaging	Het
Slco2b1	T	A	7: 99,661,536	M603L	probably benign	Het
Sncaip	A	G	18: 52,868,709	T101A	probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Stk11	T	C	10: 80,126,086	V47A	probably damaging	Het
Sv2b	T	G	7: 75,136,392	M427L	probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	T	C	12: 75,854,149		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Tas2r123	T	C	6: 132,847,332	V64A	probably benign	Het
Tm9sf1	A	T	14: 55,641,429	F169I	possibly damaging	Het
Tmpo	A	C	10: 91,163,096	I276M	probably benign	Het
Tnnc1	A	G	14: 31,211,408	D149G	probably damaging	Het
Tpr	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	1: 150,423,667		probably null	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Trim55	G	T	3: 19,671,092	V258L	possibly damaging	Het
Trpm1	G	A	7: 64,223,758	G587D	probably damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ube2u	A	G	4: 100,486,673	I90V	probably benign	Het
Upb1	T	C	10: 75,415,083		probably null	Het
Vmn2r57	A	T	7: 41,427,792	S317T	possibly damaging	Het
Wdr73	G	A	7: 80,897,950	Q107*	probably null	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het

Other mutations in Gucy2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00916:Gucy2e	APN	11	69223097	missense	possibly damaging	0.88
IGL01626:Gucy2e	APN	11	69232855	missense	possibly damaging	0.80
IGL01756:Gucy2e	APN	11	69232852	missense	probably damaging	0.98
IGL02030:Gucy2e	APN	11	69223816	missense	probably damaging	1.00
IGL02095:Gucy2e	APN	11	69232787	missense	possibly damaging	0.48
IGL02387:Gucy2e	APN	11	69236116	missense	probably benign
IGL02622:Gucy2e	APN	11	69225031	missense	probably damaging	1.00
IGL02660:Gucy2e	APN	11	69232007	missense	probably benign	0.18
IGL03181:Gucy2e	APN	11	69230182	splice site	probably benign
R0110:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0115:Gucy2e	UTSW	11	69236632	missense	unknown
R0450:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R0497:Gucy2e	UTSW	11	69224159	missense	probably damaging	1.00
R0510:Gucy2e	UTSW	11	69235576	missense	probably benign	0.00
R1252:Gucy2e	UTSW	11	69235659	missense	probably benign
R1535:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
R1700:Gucy2e	UTSW	11	69232058	missense	probably benign
R2035:Gucy2e	UTSW	11	69227532	missense	probably benign	0.12
R2179:Gucy2e	UTSW	11	69228578	splice site	probably null
R3622:Gucy2e	UTSW	11	69225051	missense	probably damaging	1.00
R4212:Gucy2e	UTSW	11	69228123	missense	probably damaging	0.99
R4600:Gucy2e	UTSW	11	69236168	missense	possibly damaging	0.71
R4790:Gucy2e	UTSW	11	69228448	missense	probably damaging	1.00
R5170:Gucy2e	UTSW	11	69235570	missense	probably damaging	0.97
R5174:Gucy2e	UTSW	11	69236566	missense	probably benign
R5440:Gucy2e	UTSW	11	69223646	missense	probably damaging	0.98
R5586:Gucy2e	UTSW	11	69226256	missense	probably damaging	1.00
R5668:Gucy2e	UTSW	11	69228381	missense	probably damaging	1.00
R5820:Gucy2e	UTSW	11	69232696	missense	probably benign	0.36
R5826:Gucy2e	UTSW	11	69236033	missense	possibly damaging	0.53
R6169:Gucy2e	UTSW	11	69236104	missense	probably benign	0.19
R6544:Gucy2e	UTSW	11	69235657	missense	probably benign
R6815:Gucy2e	UTSW	11	69232001	missense	possibly damaging	0.86
R7020:Gucy2e	UTSW	11	69232793	missense	probably benign	0.00
R7592:Gucy2e	UTSW	11	69223324	critical splice donor site	probably null
R7658:Gucy2e	UTSW	11	69226229	nonsense	probably null
R7812:Gucy2e	UTSW	11	69226243	missense	probably damaging	1.00
R8284:Gucy2e	UTSW	11	69232351	missense	probably benign
R8479:Gucy2e	UTSW	11	69232963	missense	probably benign	0.22
R8537:Gucy2e	UTSW	11	69236353	missense	probably benign	0.01
R8806:Gucy2e	UTSW	11	69236116	missense	probably benign
R9030:Gucy2e	UTSW	11	69225001	missense	probably damaging	1.00
R9192:Gucy2e	UTSW	11	69236477	missense	probably damaging	1.00
R9217:Gucy2e	UTSW	11	69235952	missense	possibly damaging	0.63
R9304:Gucy2e	UTSW	11	69235734	missense	probably benign	0.20
R9566:Gucy2e	UTSW	11	69228121	missense	probably damaging	1.00
X0025:Gucy2e	UTSW	11	69226244	missense	probably damaging	1.00
Z1186:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1186:Gucy2e	UTSW	11	69236603	missense	unknown
Z1187:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1187:Gucy2e	UTSW	11	69236603	missense	unknown
Z1188:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1188:Gucy2e	UTSW	11	69236603	missense	unknown
Z1189:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1189:Gucy2e	UTSW	11	69236603	missense	unknown
Z1190:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1190:Gucy2e	UTSW	11	69236603	missense	unknown
Z1191:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1191:Gucy2e	UTSW	11	69236603	missense	unknown
Z1192:Gucy2e	UTSW	11	69223605	missense	probably benign	0.00
Z1192:Gucy2e	UTSW	11	69236603	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTACAGTTTACGCCCCATTGACTC -3'
(R):5'- AGAACTGGCTCTGACTGATGGCTC -3'

Sequencing Primer
(F):5'- tccaccctctccttgcc -3'
(R):5'- TGACTGATGGCTCCCTGG -3'

Posted On

2013-05-23