Incidental Mutation 'R5522:Zcchc2'
ID431587
Institutional Source Beutler Lab
Gene Symbol Zcchc2
Ensembl Gene ENSMUSG00000038866
Gene Namezinc finger, CCHC domain containing 2
Synonyms9930114B20Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location105990406-106034074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106023696 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 587 (N587S)
Ref Sequence ENSEMBL: ENSMUSP00000113128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118196] [ENSMUST00000119166] [ENSMUST00000131830]
Predicted Effect probably benign
Transcript: ENSMUST00000118196
AA Change: N587S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113974
Gene: ENSMUSG00000038866
AA Change: N587S

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119166
AA Change: N587S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113128
Gene: ENSMUSG00000038866
AA Change: N587S

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 34 67 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
SCOP:d1gd5a_ 347 451 5e-7 SMART
low complexity region 480 491 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 624 634 N/A INTRINSIC
low complexity region 640 659 N/A INTRINSIC
low complexity region 777 795 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
low complexity region 998 1010 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
ZnF_C2HC 1120 1136 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131830
Predicted Effect unknown
Transcript: ENSMUST00000186983
AA Change: N184S
Predicted Effect unknown
Transcript: ENSMUST00000188954
AA Change: N203S
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Zcchc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc2 APN 1 106030263 missense probably benign 0.25
IGL01339:Zcchc2 APN 1 106029775 missense probably damaging 1.00
IGL01981:Zcchc2 APN 1 106027499 missense probably damaging 1.00
IGL02172:Zcchc2 APN 1 106000934 missense probably benign 0.00
IGL02864:Zcchc2 APN 1 106016084 missense probably damaging 1.00
IGL02993:Zcchc2 APN 1 106030168 missense probably damaging 0.99
IGL03163:Zcchc2 APN 1 106031111 missense probably damaging 1.00
P0042:Zcchc2 UTSW 1 106030997 missense possibly damaging 0.95
R0200:Zcchc2 UTSW 1 106004123 missense probably damaging 1.00
R0477:Zcchc2 UTSW 1 106030270 missense possibly damaging 0.91
R0501:Zcchc2 UTSW 1 106016091 missense possibly damaging 0.88
R0689:Zcchc2 UTSW 1 106030504 nonsense probably null
R1799:Zcchc2 UTSW 1 106030287 missense probably benign 0.00
R2016:Zcchc2 UTSW 1 106004121 splice site probably null
R2153:Zcchc2 UTSW 1 106021723 splice site probably null
R2175:Zcchc2 UTSW 1 106027423 missense probably damaging 1.00
R2999:Zcchc2 UTSW 1 106030024 missense probably benign 0.00
R3113:Zcchc2 UTSW 1 105991022 missense unknown
R4571:Zcchc2 UTSW 1 106031257 missense possibly damaging 0.66
R4670:Zcchc2 UTSW 1 105990266 unclassified probably benign
R5067:Zcchc2 UTSW 1 106030964 missense probably damaging 1.00
R5423:Zcchc2 UTSW 1 106030700 missense probably damaging 1.00
R5499:Zcchc2 UTSW 1 106030592 missense possibly damaging 0.71
R5526:Zcchc2 UTSW 1 106030254 nonsense probably null
R5571:Zcchc2 UTSW 1 106023672 missense probably benign
R5599:Zcchc2 UTSW 1 106032150 missense probably damaging 1.00
R6133:Zcchc2 UTSW 1 106019879 missense probably damaging 1.00
R6191:Zcchc2 UTSW 1 105990170 unclassified probably benign
R6194:Zcchc2 UTSW 1 105991117 missense probably damaging 1.00
R6246:Zcchc2 UTSW 1 106030066 missense possibly damaging 0.75
R7089:Zcchc2 UTSW 1 106030481 missense probably damaging 1.00
R7626:Zcchc2 UTSW 1 106001012 missense possibly damaging 0.69
R7749:Zcchc2 UTSW 1 106018273 missense probably damaging 1.00
R7781:Zcchc2 UTSW 1 106004165 missense probably damaging 1.00
R7792:Zcchc2 UTSW 1 106018252 missense probably damaging 0.99
R7982:Zcchc2 UTSW 1 106031171 missense probably damaging 1.00
R8316:Zcchc2 UTSW 1 106032114 missense probably damaging 1.00
R8351:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8451:Zcchc2 UTSW 1 106030932 missense probably damaging 0.98
R8697:Zcchc2 UTSW 1 106030764 missense probably damaging 0.98
R8862:Zcchc2 UTSW 1 106031268 makesense probably null
RF022:Zcchc2 UTSW 1 106011742 missense possibly damaging 0.85
Z1176:Zcchc2 UTSW 1 105991126 missense probably damaging 1.00
Z1177:Zcchc2 UTSW 1 106004136 missense possibly damaging 0.74
Z1177:Zcchc2 UTSW 1 106029825 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACAGAAGTCAAGCTGTTATGG -3'
(R):5'- ACTGGAAACTGCTGTACATGGC -3'

Sequencing Primer
(F):5'- CAAGCTGTTATGGGGGTAGAGCTC -3'
(R):5'- TGCTGTACATGGCAGGGAG -3'
Posted On2016-10-05