Incidental Mutation 'R5522:Nuf2'
ID431589
Institutional Source Beutler Lab
Gene Symbol Nuf2
Ensembl Gene ENSMUSG00000026683
Gene NameNUF2, NDC80 kinetochore complex component
SynonymsNuf2R, Cdca1, 2410003C07Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5522 (G1)
Quality Score171
Status Not validated
Chromosome1
Chromosomal Location169497934-169531464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 169498884 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 433 (Y433H)
Ref Sequence ENSEMBL: ENSMUSP00000106999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028000] [ENSMUST00000111368]
Predicted Effect probably damaging
Transcript: ENSMUST00000028000
AA Change: Y433H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028000
Gene: ENSMUSG00000026683
AA Change: Y433H

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 9.7e-46 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111368
AA Change: Y433H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106999
Gene: ENSMUSG00000026683
AA Change: Y433H

DomainStartEndE-ValueType
Pfam:Nuf2 3 146 6.5e-37 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to yeast Nuf2, a component of a conserved protein complex associated with the centromere. Yeast Nuf2 disappears from the centromere during meiotic prophase when centromeres lose their connection to the spindle pole body, and plays a regulatory role in chromosome segregation. The encoded protein is found to be associated with centromeres of mitotic HeLa cells, which suggests that this protein is a functional homolog of yeast Nuf2. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Nuf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Nuf2 APN 1 169522435 unclassified probably benign
IGL00980:Nuf2 APN 1 169510434 missense probably damaging 1.00
IGL01131:Nuf2 APN 1 169522364 splice site probably benign
IGL01310:Nuf2 APN 1 169498862 missense probably benign 0.12
IGL01774:Nuf2 APN 1 169506072 missense probably benign
IGL01786:Nuf2 APN 1 169510483 missense possibly damaging 0.88
IGL01866:Nuf2 APN 1 169498838 missense possibly damaging 0.68
IGL02134:Nuf2 APN 1 169513500 missense probably benign
IGL02955:Nuf2 APN 1 169507238 splice site probably benign
R0350:Nuf2 UTSW 1 169513543 critical splice acceptor site probably null
R0390:Nuf2 UTSW 1 169525297 unclassified probably benign
R0479:Nuf2 UTSW 1 169498934 splice site probably benign
R0578:Nuf2 UTSW 1 169510549 splice site probably benign
R0765:Nuf2 UTSW 1 169522936 unclassified probably benign
R1351:Nuf2 UTSW 1 169510549 splice site probably benign
R1564:Nuf2 UTSW 1 169498793 missense unknown
R3747:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3748:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3749:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R4601:Nuf2 UTSW 1 169506114 missense probably damaging 1.00
R4815:Nuf2 UTSW 1 169510468 missense probably damaging 1.00
R5473:Nuf2 UTSW 1 169507287 missense probably benign 0.05
R5716:Nuf2 UTSW 1 169522389 missense probably benign 0.23
R5742:Nuf2 UTSW 1 169516622 missense probably damaging 1.00
R6583:Nuf2 UTSW 1 169504548 missense probably benign
R6680:Nuf2 UTSW 1 169515009 splice site probably null
R7068:Nuf2 UTSW 1 169522419 missense probably damaging 1.00
R7099:Nuf2 UTSW 1 169506072 missense probably benign
R7186:Nuf2 UTSW 1 169525385 missense probably damaging 0.99
R7527:Nuf2 UTSW 1 169498853 missense possibly damaging 0.55
R7578:Nuf2 UTSW 1 169504528 missense probably benign 0.00
R7836:Nuf2 UTSW 1 169525329 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACTAGTGGTACCCGTGTTAGTG -3'
(R):5'- TCAGCTGTAGTCGTTGGTCC -3'

Sequencing Primer
(F):5'- AGCTGATATTGCAGGTACTTCC -3'
(R):5'- TCCTGGGTAGAAAAGATCTAAGCTC -3'
Posted On2016-10-05