Incidental Mutation 'R5522:Taf3'
ID431590
Institutional Source Beutler Lab
Gene Symbol Taf3
Ensembl Gene ENSMUSG00000025782
Gene NameTATA-box binding protein associated factor 3
SynonymsmTAFII140, 4933439M23Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5522 (G1)
Quality Score159
Status Not validated
Chromosome2
Chromosomal Location9914552-10048596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9941005 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 596 (K596R)
Ref Sequence ENSEMBL: ENSMUSP00000110559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026888] [ENSMUST00000114909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026888
AA Change: K749R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026888
Gene: ENSMUSG00000025782
AA Change: K749R

DomainStartEndE-ValueType
BTP 3 79 1.94e-34 SMART
low complexity region 159 173 N/A INTRINSIC
low complexity region 237 253 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
coiled coil region 519 572 N/A INTRINSIC
coiled coil region 611 651 N/A INTRINSIC
coiled coil region 692 751 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
low complexity region 795 821 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
PHD 869 915 4.77e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114909
AA Change: K596R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110559
Gene: ENSMUSG00000025782
AA Change: K596R

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
low complexity region 334 352 N/A INTRINSIC
coiled coil region 366 419 N/A INTRINSIC
coiled coil region 458 498 N/A INTRINSIC
coiled coil region 539 598 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 642 668 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
PHD 716 762 4.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129720
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The highly conserved RNA polymerase II transcription factor TFIID (see TAF1; MIM 313650) comprises the TATA box-binding protein (TBP; MIM 600075) and a set of TBP-associated factors (TAFs), including TAF3. TAFs contribute to promoter recognition and selectivity and act as antiapoptotic factors (Gangloff et al., 2001 [PubMed 11438666]).[supplied by OMIM, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Taf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Taf3 APN 2 9952917 missense probably damaging 1.00
IGL01620:Taf3 APN 2 9952661 missense probably benign 0.00
IGL02084:Taf3 APN 2 10042519 missense probably benign 0.08
IGL02229:Taf3 APN 2 9952834 missense probably damaging 1.00
IGL02891:Taf3 APN 2 9921227 missense probably damaging 1.00
IGL03173:Taf3 APN 2 9952927 missense probably damaging 0.99
IGL03302:Taf3 APN 2 9952131 missense probably damaging 1.00
Howard UTSW 2 9951160 missense probably damaging 0.99
R0344:Taf3 UTSW 2 9951898 missense probably benign 0.05
R0348:Taf3 UTSW 2 10042644 missense probably benign 0.05
R0506:Taf3 UTSW 2 9940993 missense probably benign 0.00
R1724:Taf3 UTSW 2 9952366 missense probably benign 0.01
R2151:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2154:Taf3 UTSW 2 9951566 missense possibly damaging 0.82
R2495:Taf3 UTSW 2 9952833 missense probably damaging 1.00
R3702:Taf3 UTSW 2 9952561 missense possibly damaging 0.74
R3739:Taf3 UTSW 2 9951658 missense possibly damaging 0.89
R3921:Taf3 UTSW 2 10048298 missense probably benign 0.06
R4097:Taf3 UTSW 2 9952367 missense possibly damaging 0.54
R4602:Taf3 UTSW 2 9952657 missense probably damaging 0.96
R4615:Taf3 UTSW 2 9952090 missense probably damaging 1.00
R4679:Taf3 UTSW 2 10048564 utr 5 prime probably benign
R4789:Taf3 UTSW 2 9951959 missense probably damaging 1.00
R4801:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R4802:Taf3 UTSW 2 9951123 missense possibly damaging 0.72
R5201:Taf3 UTSW 2 9952184 missense probably damaging 1.00
R5629:Taf3 UTSW 2 9918178 missense probably damaging 1.00
R6427:Taf3 UTSW 2 9951353 missense probably damaging 0.98
R6492:Taf3 UTSW 2 9951160 missense probably damaging 0.99
R6804:Taf3 UTSW 2 9918217 missense possibly damaging 0.91
R7282:Taf3 UTSW 2 9951442 missense probably damaging 0.96
R7293:Taf3 UTSW 2 9952090 missense probably damaging 0.98
R7368:Taf3 UTSW 2 9916377 missense unknown
R7637:Taf3 UTSW 2 9940993 missense probably benign 0.00
R7686:Taf3 UTSW 2 9951488 missense probably damaging 1.00
R8251:Taf3 UTSW 2 9918151 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCTGATGGCAGAGAGTTCC -3'
(R):5'- GAGCTATTGAAAATCACAGAATGGC -3'

Sequencing Primer
(F):5'- ATGGCAGAGAGTTCCTGGCAC -3'
(R):5'- GATGTGCTTCAACCATAAGGACCTG -3'
Posted On2016-10-05