Incidental Mutation 'R5522:Cerkl'
ID431592
Institutional Source Beutler Lab
Gene Symbol Cerkl
Ensembl Gene ENSMUSG00000075256
Gene Nameceramide kinase-like
SynonymsRp26
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location79330543-79456785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79392984 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 131 (H131R)
Ref Sequence ENSEMBL: ENSMUSP00000114325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143974]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143602
Predicted Effect probably benign
Transcript: ENSMUST00000143974
AA Change: H131R

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114325
Gene: ENSMUSG00000075256
AA Change: H131R

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Pfam:DAGK_cat 152 293 2.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153602
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit retinal apoptosis and decreased amplitudes and increased implicit time of oscillatory potentials. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Cerkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Cerkl APN 2 79341499 missense probably benign 0.00
IGL01330:Cerkl APN 2 79368781 missense possibly damaging 0.90
IGL01468:Cerkl APN 2 79343215 critical splice donor site probably null
IGL01946:Cerkl APN 2 79393020 missense probably benign 0.19
IGL02027:Cerkl APN 2 79341286 unclassified probably benign
IGL02809:Cerkl APN 2 79342202 missense possibly damaging 0.54
IGL03293:Cerkl APN 2 79342375 missense probably damaging 0.98
R0076:Cerkl UTSW 2 79343289 missense possibly damaging 0.93
R0453:Cerkl UTSW 2 79342451 missense probably benign 0.25
R0918:Cerkl UTSW 2 79333629 missense probably benign 0.00
R1533:Cerkl UTSW 2 79341357 missense possibly damaging 0.94
R4003:Cerkl UTSW 2 79428794 missense possibly damaging 0.86
R5078:Cerkl UTSW 2 79393008 missense probably benign 0.29
R5093:Cerkl UTSW 2 79333523 missense probably damaging 1.00
R5431:Cerkl UTSW 2 79341335 missense probably damaging 1.00
R6249:Cerkl UTSW 2 79368778 missense probably damaging 1.00
R7036:Cerkl UTSW 2 79341378 missense probably benign 0.03
R7201:Cerkl UTSW 2 79333590 missense probably benign 0.00
R7326:Cerkl UTSW 2 79332605 missense probably benign 0.37
R7343:Cerkl UTSW 2 79428760 missense probably damaging 1.00
R7833:Cerkl UTSW 2 79341380 missense probably benign 0.01
R7874:Cerkl UTSW 2 79338637 missense probably damaging 1.00
R8190:Cerkl UTSW 2 79333557 missense probably benign 0.17
R8333:Cerkl UTSW 2 79338578 missense possibly damaging 0.65
Z1176:Cerkl UTSW 2 79368765 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCAGAAAAGTAACTTGCGGG -3'
(R):5'- AGCAAAGAAGAGTCCCTAGAACTTG -3'

Sequencing Primer
(F):5'- GAGCCACTAAGTGCTGAGTCTTC -3'
(R):5'- GAGTCCCTAGAACTTGAAGACATC -3'
Posted On2016-10-05