Incidental Mutation 'R5522:Usp24'
ID 431597
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2810030C21Rik, 2700066K03Rik
MMRRC Submission 043081-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5522 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 106316213-106441322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106372721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 797 (V797E)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably damaging
Transcript: ENSMUST00000094933
AA Change: V796E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: V796E

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165709
AA Change: V797E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: V797E

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106373756 missense probably damaging 1.00
R8546:Usp24 UTSW 4 106402129 missense probably benign 0.01
R8798:Usp24 UTSW 4 106379239 missense probably benign 0.00
R8822:Usp24 UTSW 4 106412213 missense probably benign 0.17
R8992:Usp24 UTSW 4 106377565 missense probably benign 0.36
R9002:Usp24 UTSW 4 106418215 missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106379054 missense probably damaging 0.99
R9068:Usp24 UTSW 4 106375678 missense probably benign 0.09
R9096:Usp24 UTSW 4 106397311 missense probably benign 0.00
R9180:Usp24 UTSW 4 106359050 missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106387484 missense probably damaging 1.00
R9201:Usp24 UTSW 4 106420530 missense probably benign 0.36
R9251:Usp24 UTSW 4 106360518 missense probably benign 0.19
R9423:Usp24 UTSW 4 106431670 missense probably damaging 1.00
R9459:Usp24 UTSW 4 106342358 missense probably damaging 1.00
R9472:Usp24 UTSW 4 106403931 missense probably benign 0.00
R9483:Usp24 UTSW 4 106362182 missense probably damaging 0.99
R9534:Usp24 UTSW 4 106407115 missense probably damaging 0.97
R9653:Usp24 UTSW 4 106347367 missense probably benign 0.03
R9712:Usp24 UTSW 4 106347367 missense probably benign 0.03
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCACACCACACTTTAGATGC -3'
(R):5'- TTCCTAGATGCTGAGGGGAGAG -3'

Sequencing Primer
(F):5'- CACTTTAGATGCCTGTTTGAGAAGCC -3'
(R):5'- AAGGGAGCCTCTGCCACTAATG -3'
Posted On 2016-10-05