Mutagenetix > Incidental Mutation

Incidental Mutation 'R5522:Cfap57'

431600

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

043081-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5522 (G1)

Quality Score

181

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118595888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 539 (N539K)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably benign
Transcript: ENSMUST00000071972
AA Change: N539K

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: N539K

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921
AA Change: N539K

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: N539K

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 97.4%
10x: 93.9%
20x: 85.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	G	A	2: 130,814,302		probably benign	Het
Adgrl1	T	C	8: 83,923,075	Y121H	possibly damaging	Het
Agbl5	G	A	5: 30,893,903		probably null	Het
Atp13a2	T	A	4: 141,004,360		probably null	Het
Cd69	A	T	6: 129,271,416	S36T	probably damaging	Het
Ceacam5	A	T	7: 17,715,080	I124L	probably benign	Het
Cerkl	T	C	2: 79,392,984	H131R	probably benign	Het
Cyp4x1	C	A	4: 115,121,977	W141L	probably damaging	Het
Dlgap1	T	C	17: 70,516,998		probably null	Het
Dst	T	C	1: 34,257,873	I5781T	possibly damaging	Het
Epha2	T	A	4: 141,308,556	V101E	probably damaging	Het
Exph5	T	C	9: 53,374,313	F898S	possibly damaging	Het
Fyco1	G	A	9: 123,794,771	R1398*	probably null	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Grb10	T	C	11: 11,936,746	I508V	probably benign	Het
Igf1r	C	A	7: 68,183,510	Q473K	probably damaging	Het
Ighv1-66	T	A	12: 115,593,135	D109V	probably damaging	Het
Ipmk	C	A	10: 71,363,474	T55K	probably benign	Het
Kdm2b	A	G	5: 122,949,162	Y192H	probably damaging	Het
Krt32	A	T	11: 100,086,671		probably null	Het
Kti12	T	A	4: 108,848,423	L178Q	possibly damaging	Het
Mchr1	A	T	15: 81,238,010	K320N	possibly damaging	Het
Mdn1	T	C	4: 32,685,783	L858S	probably damaging	Het
Myo3a	T	A	2: 22,574,341	F198Y	probably damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nfatc1	T	C	18: 80,653,529	T647A	probably benign	Het
Nuf2	A	G	1: 169,498,884	Y433H	probably damaging	Het
Nup210l	T	C	3: 90,154,665	V717A	probably benign	Het
Olfr183	A	T	16: 58,999,905	L73F	probably benign	Het
Olfr401	A	G	11: 74,121,658	Y123C	probably damaging	Het
Olfr781	A	T	10: 129,332,929	D16V	probably damaging	Het
Pbrm1	A	G	14: 31,089,563	Y1210C	probably damaging	Het
Pcdhb6	A	G	18: 37,334,349	I108V	probably benign	Het
Plac8	T	A	5: 100,562,718	T6S	probably benign	Het
Plbd1	A	T	6: 136,617,300	V317E	probably benign	Het
Rars	A	T	11: 35,817,368	Y406*	probably null	Het
Scamp3	T	C	3: 89,177,622	F11L	possibly damaging	Het
Sctr	A	G	1: 120,036,416	N142S	probably benign	Het
Sh2d4a	T	C	8: 68,296,697	S128P	probably benign	Het
Snrnp70	C	T	7: 45,377,177		probably benign	Het
Taf3	T	C	2: 9,941,005	K596R	probably damaging	Het
Tango6	T	C	8: 106,695,598		probably null	Het
Taok3	A	G	5: 117,273,757	T414A	probably benign	Het
Tmem104	G	A	11: 115,188,323		probably null	Het
Tmem231	T	A	8: 111,918,410	S155C	possibly damaging	Het
Tssk3	G	A	4: 129,489,550	R110W	possibly damaging	Het
Ugt2b37	T	C	5: 87,240,900	T485A	probably benign	Het
Unc5b	T	C	10: 60,778,195	K292E	possibly damaging	Het
Upf3a	T	A	8: 13,795,497		probably null	Het
Usp24	T	A	4: 106,372,721	V797E	probably damaging	Het
Vcan	T	C	13: 89,691,810	T1872A	possibly damaging	Het
Vmn1r195	A	G	13: 22,278,950	M197V	probably damaging	Het
Vmn2r40	T	A	7: 8,908,204	T697S	probably benign	Het
Xab2	A	T	8: 3,611,718	D578E	probably benign	Het
Xpo7	A	T	14: 70,671,650	Y810*	probably null	Het
Zcchc2	A	G	1: 106,023,696	N587S	probably benign	Het
Zfp189	C	T	4: 49,529,739	R281*	probably null	Het
Zranb1	T	C	7: 132,983,949	*735R	probably null	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGTCTTCTGTAGCACTGAGG -3'
(R):5'- GCTATAGTGTATTAGAGCCCCTGAG -3'

Sequencing Primer
(F):5'- CTGAGGAGCAGCCAGAGTG -3'
(R):5'- ATTAGAGCCCCTGAGTTTGTC -3'

Posted On

2016-10-05