Incidental Mutation 'R5522:Tssk3'
ID431602
Institutional Source Beutler Lab
Gene Symbol Tssk3
Ensembl Gene ENSMUSG00000000411
Gene Nametestis-specific serine kinase 3
SynonymsStk22c, Tssk-3, 4930594I21Rik, 1700014N07Rik, Stk22d
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129489014-129491022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129489550 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 110 (R110W)
Ref Sequence ENSEMBL: ENSMUSP00000000421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000421] [ENSMUST00000048162] [ENSMUST00000106043]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000421
AA Change: R110W

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000421
Gene: ENSMUSG00000000411
AA Change: R110W

DomainStartEndE-ValueType
S_TKc 10 265 3.46e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048162
SMART Domains Protein: ENSMUSP00000048742
Gene: ENSMUSG00000040859

DomainStartEndE-ValueType
BSD 146 198 4.61e-18 SMART
low complexity region 217 229 N/A INTRINSIC
low complexity region 261 279 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106043
SMART Domains Protein: ENSMUSP00000101658
Gene: ENSMUSG00000078554

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
Pfam:UPF0731 56 128 3.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145488
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase expressed exclusively in the testis that is thought to play a role in either germ cell differentiation or mature sperm function. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Tssk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4115:Tssk3 UTSW 4 129489507 missense probably damaging 1.00
R4224:Tssk3 UTSW 4 129490599 missense probably benign 0.22
R4320:Tssk3 UTSW 4 129489201 missense possibly damaging 0.48
R4579:Tssk3 UTSW 4 129489317 missense probably benign 0.01
R6263:Tssk3 UTSW 4 129489258 missense probably benign 0.05
R7216:Tssk3 UTSW 4 129489313 frame shift probably null
R8492:Tssk3 UTSW 4 129489652 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGCTATCATGGGGTATGCC -3'
(R):5'- AGAGATTCCTGCCTCGTGAG -3'

Sequencing Primer
(F):5'- TGTGCTGCCACAGAAGGTCTG -3'
(R):5'- GTGAGCTCCAGATTGTCCGTAC -3'
Posted On2016-10-05