Incidental Mutation 'R5522:Ugt2b37'
ID431605
Institutional Source Beutler Lab
Gene Symbol Ugt2b37
Ensembl Gene ENSMUSG00000057425
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B37
Synonyms0610033E06Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87240493-87254804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87240900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 485 (T485A)
Ref Sequence ENSEMBL: ENSMUSP00000075255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075858]
Predicted Effect probably benign
Transcript: ENSMUST00000075858
AA Change: T485A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075255
Gene: ENSMUSG00000057425
AA Change: T485A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 5.5e-256 PFAM
Pfam:Glyco_tran_28_C 328 449 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Ugt2b37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Ugt2b37 APN 5 87242481 missense possibly damaging 0.90
IGL00567:Ugt2b37 APN 5 87254074 missense probably damaging 1.00
IGL00787:Ugt2b37 APN 5 87242429 missense probably benign 0.00
IGL01560:Ugt2b37 APN 5 87251839 missense probably damaging 1.00
IGL01617:Ugt2b37 APN 5 87251879 missense probably damaging 1.00
IGL01982:Ugt2b37 APN 5 87242432 missense probably damaging 1.00
IGL02299:Ugt2b37 APN 5 87242315 missense probably benign 0.00
IGL02323:Ugt2b37 APN 5 87250564 splice site probably benign
IGL02326:Ugt2b37 APN 5 87241002 missense probably benign 0.25
IGL02516:Ugt2b37 APN 5 87240882 missense probably damaging 1.00
IGL03285:Ugt2b37 APN 5 87240875 missense probably damaging 1.00
R0076:Ugt2b37 UTSW 5 87254221 missense probably benign 0.31
R0141:Ugt2b37 UTSW 5 87240983 missense probably damaging 1.00
R0312:Ugt2b37 UTSW 5 87250665 missense probably damaging 1.00
R0359:Ugt2b37 UTSW 5 87250584 missense probably benign 0.10
R0523:Ugt2b37 UTSW 5 87251832 missense possibly damaging 0.91
R1938:Ugt2b37 UTSW 5 87240857 missense probably damaging 1.00
R1962:Ugt2b37 UTSW 5 87254334 missense probably damaging 1.00
R2496:Ugt2b37 UTSW 5 87254710 missense probably damaging 0.97
R3704:Ugt2b37 UTSW 5 87242987 missense possibly damaging 0.55
R4430:Ugt2b37 UTSW 5 87254092 missense probably benign 0.00
R4825:Ugt2b37 UTSW 5 87250639 missense possibly damaging 0.91
R5043:Ugt2b37 UTSW 5 87251860 nonsense probably null
R5098:Ugt2b37 UTSW 5 87242953 missense probably damaging 1.00
R5174:Ugt2b37 UTSW 5 87251880 missense probably benign 0.00
R5879:Ugt2b37 UTSW 5 87254406 missense probably benign
R5999:Ugt2b37 UTSW 5 87254177 missense probably benign 0.25
R6374:Ugt2b37 UTSW 5 87242420 missense probably damaging 1.00
R6454:Ugt2b37 UTSW 5 87240977 missense probably damaging 1.00
R6857:Ugt2b37 UTSW 5 87240846 missense probably damaging 0.98
R6875:Ugt2b37 UTSW 5 87242429 missense probably benign 0.00
R6916:Ugt2b37 UTSW 5 87254600 missense probably benign 0.07
R7099:Ugt2b37 UTSW 5 87240989 missense probably benign 0.00
R7239:Ugt2b37 UTSW 5 87254731 missense probably benign
R7470:Ugt2b37 UTSW 5 87254112 missense probably benign 0.24
R7810:Ugt2b37 UTSW 5 87254259 missense probably damaging 1.00
R7841:Ugt2b37 UTSW 5 87250630 missense probably benign 0.05
R7860:Ugt2b37 UTSW 5 87254330 missense probably damaging 1.00
R7861:Ugt2b37 UTSW 5 87242440 nonsense probably null
R8200:Ugt2b37 UTSW 5 87240891 nonsense probably null
R8211:Ugt2b37 UTSW 5 87242376 missense probably benign 0.07
R8282:Ugt2b37 UTSW 5 87254581 missense probably benign 0.01
R8312:Ugt2b37 UTSW 5 87242940 missense probably benign 0.15
R8520:Ugt2b37 UTSW 5 87240855 missense probably benign 0.04
R8688:Ugt2b37 UTSW 5 87242381 missense possibly damaging 0.52
R8695:Ugt2b37 UTSW 5 87242384 missense probably benign 0.00
R8772:Ugt2b37 UTSW 5 87254486 missense probably benign 0.00
R8839:Ugt2b37 UTSW 5 87254556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATTCATGTGGTGCATTGAC -3'
(R):5'- TCATAGGGCAGCTCAATGGATAAG -3'

Sequencing Primer
(F):5'- GCATTGACAATGAACTCTACTCATTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2016-10-05