Incidental Mutation 'R5522:Ceacam5'
ID431612
Institutional Source Beutler Lab
Gene Symbol Ceacam5
Ensembl Gene ENSMUSG00000008789
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 5
SynonymsPsg30, 1600029H12Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17713238-17761132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17715080 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 124 (I124L)
Ref Sequence ENSEMBL: ENSMUSP00000080582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081907]
Predicted Effect probably benign
Transcript: ENSMUST00000081907
AA Change: I124L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789
AA Change: I124L

DomainStartEndE-ValueType
IG 40 141 4.46e-1 SMART
IG_like 160 261 2.96e1 SMART
IG_like 277 378 5.86e0 SMART
IG_like 397 496 4.07e1 SMART
IG 514 615 2.64e0 SMART
IG_like 634 735 2.81e1 SMART
IG 753 853 1.72e-2 SMART
IGc2 869 933 1.28e-10 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Ceacam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ceacam5 APN 7 17759556 nonsense probably null
IGL00981:Ceacam5 APN 7 17745533 missense probably benign 0.08
IGL01314:Ceacam5 APN 7 17747256 nonsense probably null
IGL01329:Ceacam5 APN 7 17745609 missense probably damaging 0.98
IGL01389:Ceacam5 APN 7 17747375 missense probably damaging 0.96
IGL01418:Ceacam5 APN 7 17745599 missense probably damaging 1.00
IGL02418:Ceacam5 APN 7 17759434 missense possibly damaging 0.71
IGL02734:Ceacam5 APN 7 17750812 missense probably damaging 1.00
IGL03220:Ceacam5 APN 7 17760728 missense probably damaging 1.00
IGL03377:Ceacam5 APN 7 17715131 missense probably benign 0.15
IGL03395:Ceacam5 APN 7 17745379 splice site probably benign
IGL03054:Ceacam5 UTSW 7 17759454 missense possibly damaging 0.71
R0456:Ceacam5 UTSW 7 17760851 missense possibly damaging 0.63
R0624:Ceacam5 UTSW 7 17714963 missense probably benign 0.03
R0847:Ceacam5 UTSW 7 17757837 missense possibly damaging 0.71
R0879:Ceacam5 UTSW 7 17757702 missense probably benign 0.16
R0945:Ceacam5 UTSW 7 17747344 missense probably damaging 1.00
R1382:Ceacam5 UTSW 7 17752165 missense probably benign 0.33
R1474:Ceacam5 UTSW 7 17747234 missense probably damaging 1.00
R1526:Ceacam5 UTSW 7 17750695 missense probably damaging 1.00
R1793:Ceacam5 UTSW 7 17747395 missense probably benign 0.01
R1851:Ceacam5 UTSW 7 17714910 nonsense probably null
R1907:Ceacam5 UTSW 7 17752384 missense possibly damaging 0.85
R1913:Ceacam5 UTSW 7 17759577 nonsense probably null
R1990:Ceacam5 UTSW 7 17757880 missense probably damaging 0.99
R1999:Ceacam5 UTSW 7 17747247 missense possibly damaging 0.66
R2336:Ceacam5 UTSW 7 17747375 missense probably benign 0.28
R2355:Ceacam5 UTSW 7 17745635 missense probably damaging 1.00
R3106:Ceacam5 UTSW 7 17747323 missense probably benign 0.06
R3423:Ceacam5 UTSW 7 17757637 missense possibly damaging 0.52
R3432:Ceacam5 UTSW 7 17714976 missense probably benign 0.06
R3686:Ceacam5 UTSW 7 17760823 missense possibly damaging 0.94
R3713:Ceacam5 UTSW 7 17759338 missense possibly damaging 0.52
R3878:Ceacam5 UTSW 7 17750581 missense probably damaging 1.00
R4214:Ceacam5 UTSW 7 17752151 missense probably benign 0.00
R4335:Ceacam5 UTSW 7 17752129 missense probably benign
R4725:Ceacam5 UTSW 7 17760677 missense probably benign 0.26
R4823:Ceacam5 UTSW 7 17757744 missense possibly damaging 0.71
R4833:Ceacam5 UTSW 7 17752258 missense probably benign
R4986:Ceacam5 UTSW 7 17757833 missense possibly damaging 0.85
R5099:Ceacam5 UTSW 7 17745588 missense probably damaging 0.96
R5365:Ceacam5 UTSW 7 17759548 missense probably damaging 0.98
R5605:Ceacam5 UTSW 7 17747236 missense probably benign 0.03
R6199:Ceacam5 UTSW 7 17714885 missense probably benign 0.00
R6222:Ceacam5 UTSW 7 17745547 missense probably benign 0.15
R6320:Ceacam5 UTSW 7 17747198 missense probably damaging 1.00
R6464:Ceacam5 UTSW 7 17747466 critical splice donor site probably null
R6521:Ceacam5 UTSW 7 17750831 critical splice donor site probably null
R6568:Ceacam5 UTSW 7 17745491 missense probably damaging 1.00
R6573:Ceacam5 UTSW 7 17713447 start codon destroyed probably null 0.70
R6814:Ceacam5 UTSW 7 17752287 nonsense probably null
R6872:Ceacam5 UTSW 7 17752287 nonsense probably null
R6930:Ceacam5 UTSW 7 17750834 splice site probably null
R7071:Ceacam5 UTSW 7 17750652 missense possibly damaging 0.49
R7121:Ceacam5 UTSW 7 17745537 missense probably benign 0.29
R7174:Ceacam5 UTSW 7 17757914 critical splice donor site probably null
R7187:Ceacam5 UTSW 7 17759485 missense possibly damaging 0.85
R7355:Ceacam5 UTSW 7 17747387 missense probably damaging 1.00
R7411:Ceacam5 UTSW 7 17750753 missense probably damaging 0.99
R7462:Ceacam5 UTSW 7 17760839 missense probably damaging 1.00
R7612:Ceacam5 UTSW 7 17759416 missense possibly damaging 0.86
R7803:Ceacam5 UTSW 7 17759392 missense probably damaging 0.98
R7943:Ceacam5 UTSW 7 17745566 missense probably benign 0.26
R8342:Ceacam5 UTSW 7 17752246 missense possibly damaging 0.53
R8356:Ceacam5 UTSW 7 17745699 missense possibly damaging 0.68
R8426:Ceacam5 UTSW 7 17759341 missense possibly damaging 0.51
R8456:Ceacam5 UTSW 7 17745699 missense possibly damaging 0.68
R8534:Ceacam5 UTSW 7 17750746 missense probably benign 0.20
R8815:Ceacam5 UTSW 7 17759360 missense possibly damaging 0.85
R8871:Ceacam5 UTSW 7 17760902 missense probably benign 0.12
X0020:Ceacam5 UTSW 7 17760909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGTTCAGAGGAATGAG -3'
(R):5'- AAGGATTCTGGTCTATTGCCC -3'

Sequencing Primer
(F):5'- GGATTAAGAGCCCTCAAATTGGAC -3'
(R):5'- ACAGCATGTGTGTCCTGC -3'
Posted On2016-10-05