Incidental Mutation 'R5522:Zranb1'
ID431615
Institutional Source Beutler Lab
Gene Symbol Zranb1
Ensembl Gene ENSMUSG00000030967
Gene Namezinc finger, RAN-binding domain containing 1
Synonyms9330160G10Rik, D7Wsu87e
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location132931142-132986391 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 132983949 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 735 (*735R)
Ref Sequence ENSEMBL: ENSMUSP00000148867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033265] [ENSMUST00000033269] [ENSMUST00000106157] [ENSMUST00000124096] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000169570] [ENSMUST00000210507] [ENSMUST00000215716]
Predicted Effect probably null
Transcript: ENSMUST00000033265
AA Change: *709R
SMART Domains Protein: ENSMUSP00000033265
Gene: ENSMUSG00000030967
AA Change: *709R

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 9.8e-35 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106157
AA Change: *709R
SMART Domains Protein: ENSMUSP00000101763
Gene: ENSMUSG00000030967
AA Change: *709R

DomainStartEndE-ValueType
ZnF_RBZ 6 30 9.14e-5 SMART
ZnF_RBZ 86 110 6.56e-6 SMART
ZnF_RBZ 151 175 1.69e-8 SMART
low complexity region 180 195 N/A INTRINSIC
Pfam:OTU 438 586 1.5e-40 PFAM
low complexity region 698 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153335
Predicted Effect probably benign
Transcript: ENSMUST00000165457
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169570
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210507
Predicted Effect probably null
Transcript: ENSMUST00000215716
AA Change: *735R
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased CD4+ T cells and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Other mutations in Zranb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zranb1 APN 7 132982504 splice site probably benign
IGL00843:Zranb1 APN 7 132949893 missense probably benign 0.26
IGL01727:Zranb1 APN 7 132966620 missense probably damaging 1.00
IGL02087:Zranb1 APN 7 132973417 splice site probably benign
IGL02676:Zranb1 APN 7 132966681 missense probably benign 0.16
IGL03081:Zranb1 APN 7 132950397 missense probably damaging 0.99
IGL03095:Zranb1 APN 7 132949906 nonsense probably null
IGL03186:Zranb1 APN 7 132950203 missense possibly damaging 0.68
PIT4151001:Zranb1 UTSW 7 132949994 missense probably benign
R0207:Zranb1 UTSW 7 132950385 missense probably damaging 1.00
R0470:Zranb1 UTSW 7 132982771 missense probably damaging 1.00
R0854:Zranb1 UTSW 7 132949848 missense possibly damaging 0.78
R1318:Zranb1 UTSW 7 132966552 nonsense probably null
R1389:Zranb1 UTSW 7 132971333 missense probably damaging 1.00
R1480:Zranb1 UTSW 7 132950016 missense probably benign 0.39
R1656:Zranb1 UTSW 7 132949767 missense probably benign 0.31
R1956:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R1958:Zranb1 UTSW 7 132982729 missense probably damaging 1.00
R2010:Zranb1 UTSW 7 132966696 critical splice donor site probably null
R2289:Zranb1 UTSW 7 132950039 missense probably damaging 1.00
R3831:Zranb1 UTSW 7 132982776 missense probably damaging 0.98
R4128:Zranb1 UTSW 7 132966552 nonsense probably null
R4745:Zranb1 UTSW 7 132972714 missense probably damaging 0.97
R5121:Zranb1 UTSW 7 132950187 missense probably benign 0.06
R5262:Zranb1 UTSW 7 132982827 small insertion probably benign
R5263:Zranb1 UTSW 7 132982827 small insertion probably benign
R5264:Zranb1 UTSW 7 132982827 small insertion probably benign
R6252:Zranb1 UTSW 7 132983904 missense probably benign 0.00
R6519:Zranb1 UTSW 7 132950128 nonsense probably null
R6671:Zranb1 UTSW 7 132971313 missense probably damaging 1.00
R6827:Zranb1 UTSW 7 132949745 missense probably benign 0.17
R6928:Zranb1 UTSW 7 132966594 missense possibly damaging 0.65
R7313:Zranb1 UTSW 7 132982752 missense probably damaging 1.00
R7583:Zranb1 UTSW 7 132983896 missense probably benign 0.00
R8181:Zranb1 UTSW 7 132983779 missense probably damaging 1.00
R8236:Zranb1 UTSW 7 132949664 missense probably damaging 0.99
R8463:Zranb1 UTSW 7 132950081 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTGCCTGACATACTGTGTGAC -3'
(R):5'- GATGCAGTCAATTCTCTCCTGTG -3'

Sequencing Primer
(F):5'- TGACATACTGTGTGACTTGCC -3'
(R):5'- CAATTCTCTCCTGTGAGTGTGGAAC -3'
Posted On2016-10-05