Incidental Mutation 'R5522:Adgrl1'
ID431619
Institutional Source Beutler Lab
Gene Symbol Adgrl1
Ensembl Gene ENSMUSG00000013033
Gene Nameadhesion G protein-coupled receptor L1
Synonymslectomedin-2, Lec2, Lphn1, 2900070I05Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83900105-83941954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83923075 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 121 (Y121H)
Ref Sequence ENSEMBL: ENSMUSP00000116064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045393
AA Change: Y121H

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: Y121H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124355
AA Change: Y121H

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033
AA Change: Y121H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131717
SMART Domains Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
OLF 1 222 4.51e-103 SMART
low complexity region 229 265 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
HormR 300 365 2.26e-21 SMART
low complexity region 403 415 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
GPS 621 673 5.64e-25 SMART
Pfam:7tm_2 680 916 7.9e-68 PFAM
Pfam:Latrophilin 936 1295 2.7e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132500
AA Change: Y121H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: Y121H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139575
Predicted Effect probably benign
Transcript: ENSMUST00000141158
AA Change: Y121H

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: Y121H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152978
AA Change: Y121H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: Y121H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Adgrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adgrl1 APN 8 83937703 missense probably damaging 0.98
IGL01413:Adgrl1 APN 8 83929857 missense probably damaging 1.00
IGL02020:Adgrl1 APN 8 83932948 missense probably benign 0.09
IGL02422:Adgrl1 APN 8 83937486 missense probably damaging 1.00
IGL03065:Adgrl1 APN 8 83938514 missense possibly damaging 0.95
IGL03169:Adgrl1 APN 8 83931995 missense probably damaging 0.97
IGL03237:Adgrl1 APN 8 83929683 splice site probably null
Swiss_rolls UTSW 8 83918922 missense probably damaging 0.99
R0375:Adgrl1 UTSW 8 83934901 missense probably damaging 0.99
R0505:Adgrl1 UTSW 8 83934650 splice site probably benign
R0681:Adgrl1 UTSW 8 83934650 splice site probably benign
R0964:Adgrl1 UTSW 8 83934412 splice site probably benign
R1182:Adgrl1 UTSW 8 83929822 missense probably damaging 1.00
R1373:Adgrl1 UTSW 8 83937763 missense probably benign 0.23
R1475:Adgrl1 UTSW 8 83938350 missense possibly damaging 0.60
R1610:Adgrl1 UTSW 8 83932373 missense probably benign 0.16
R1778:Adgrl1 UTSW 8 83930037 missense probably damaging 1.00
R2089:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2300:Adgrl1 UTSW 8 83930117 nonsense probably null
R2403:Adgrl1 UTSW 8 83931241 missense probably benign 0.01
R2935:Adgrl1 UTSW 8 83934560 missense probably damaging 1.00
R3772:Adgrl1 UTSW 8 83923004 missense possibly damaging 0.59
R4191:Adgrl1 UTSW 8 83938940 missense probably benign 0.29
R4393:Adgrl1 UTSW 8 83938593 missense probably benign 0.01
R4406:Adgrl1 UTSW 8 83930042 missense probably damaging 1.00
R4445:Adgrl1 UTSW 8 83934860 missense probably damaging 1.00
R4782:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R4799:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R5214:Adgrl1 UTSW 8 83915573 splice site probably null
R5242:Adgrl1 UTSW 8 83931082 missense possibly damaging 0.47
R5409:Adgrl1 UTSW 8 83929742 missense probably damaging 1.00
R5607:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5608:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5652:Adgrl1 UTSW 8 83929815 missense probably damaging 1.00
R5655:Adgrl1 UTSW 8 83938601 missense possibly damaging 0.89
R5919:Adgrl1 UTSW 8 83932610 missense probably damaging 1.00
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6129:Adgrl1 UTSW 8 83918987 missense probably damaging 1.00
R6221:Adgrl1 UTSW 8 83937687 nonsense probably null
R7142:Adgrl1 UTSW 8 83937200 missense probably benign 0.38
R7181:Adgrl1 UTSW 8 83926249 splice site probably null
R7238:Adgrl1 UTSW 8 83939064 missense probably damaging 0.99
R7547:Adgrl1 UTSW 8 83938884 missense probably benign 0.00
R7709:Adgrl1 UTSW 8 83938988 missense probably benign 0.03
R7741:Adgrl1 UTSW 8 83929714 missense probably damaging 1.00
R7852:Adgrl1 UTSW 8 83935558 missense probably damaging 1.00
R7866:Adgrl1 UTSW 8 83937935 critical splice donor site probably null
R8146:Adgrl1 UTSW 8 83930989 missense possibly damaging 0.64
R8314:Adgrl1 UTSW 8 83938389 missense probably damaging 1.00
R8829:Adgrl1 UTSW 8 83938829 missense
R8857:Adgrl1 UTSW 8 83931028 missense probably benign 0.24
RF007:Adgrl1 UTSW 8 83934772 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATAGCACCTTCCCTTTGGACTG -3'
(R):5'- CTGTACAGTGGGATAGCAGC -3'

Sequencing Primer
(F):5'- GGACTGCGTTTGCTCTCTGAC -3'
(R):5'- TGGGATAGCAGCCACCAAATATG -3'
Posted On2016-10-05