Incidental Mutation 'R5522:Tmem231'
ID431621
Institutional Source Beutler Lab
Gene Symbol Tmem231
Ensembl Gene ENSMUSG00000031951
Gene Nametransmembrane protein 231
Synonyms
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5522 (G1)
Quality Score212
Status Not validated
Chromosome8
Chromosomal Location111912011-111933881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111918410 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 155 (S155C)
Ref Sequence ENSEMBL: ENSMUSP00000034429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034429] [ENSMUST00000211866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034429
AA Change: S155C

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034429
Gene: ENSMUSG00000031951
AA Change: S155C

DomainStartEndE-ValueType
Pfam:TM231 1 301 5.8e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211866
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete lethality throughout fetal growth and development, defective patterning of the ventral spinal cord, a striking loss in cilia, severe vascular defects, polydactyly, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Tmem231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tmem231 APN 8 111918440 splice site probably benign
IGL02800:Tmem231 APN 8 111914032 missense probably benign 0.03
R2281:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R2306:Tmem231 UTSW 8 111918871 missense probably damaging 1.00
R3615:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R3616:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R4541:Tmem231 UTSW 8 111914592 missense probably benign 0.02
R4708:Tmem231 UTSW 8 111933786 start gained probably benign
R6266:Tmem231 UTSW 8 111915265 missense probably null 0.71
R6414:Tmem231 UTSW 8 111926892 intron probably benign
R6415:Tmem231 UTSW 8 111926892 intron probably benign
R6418:Tmem231 UTSW 8 111926892 intron probably benign
R6419:Tmem231 UTSW 8 111926892 intron probably benign
R6622:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R6938:Tmem231 UTSW 8 111933512 missense probably damaging 0.97
R7103:Tmem231 UTSW 8 111918885 splice site probably null
R7221:Tmem231 UTSW 8 111933676 missense probably benign
R7305:Tmem231 UTSW 8 111915295 missense possibly damaging 0.70
R7438:Tmem231 UTSW 8 111918408 missense probably damaging 1.00
R7781:Tmem231 UTSW 8 111918290 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCTTTGAAGGCTGTGATAAGC -3'
(R):5'- TCTTCTATGGAAAGTGACTAGGAAC -3'

Sequencing Primer
(F):5'- CTGTGATAAGCCTAGGCCTG -3'
(R):5'- CTATGGAAAGTGACTAGGAACTTAAC -3'
Posted On2016-10-05