Incidental Mutation 'R5522:Fyco1'
ID431623
Institutional Source Beutler Lab
Gene Symbol Fyco1
Ensembl Gene ENSMUSG00000025241
Gene NameFYVE and coiled-coil domain containing 1
SynonymsMem2, ZFYVE7, 2810409M01Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123789500-123851899 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 123794771 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1398 (R1398*)
Ref Sequence ENSEMBL: ENSMUSP00000133222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595]
Predicted Effect probably null
Transcript: ENSMUST00000084715
AA Change: R1398*
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241
AA Change: R1398*

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000167595
AA Change: R1398*
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241
AA Change: R1398*

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214413
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Fyco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Fyco1 APN 9 123838897 missense probably damaging 1.00
IGL01407:Fyco1 APN 9 123828879 missense probably damaging 1.00
IGL01621:Fyco1 APN 9 123827182 unclassified probably benign
IGL01908:Fyco1 APN 9 123829230 missense probably damaging 1.00
IGL02006:Fyco1 APN 9 123829831 nonsense probably null
IGL02899:Fyco1 APN 9 123830331 missense possibly damaging 0.47
IGL03166:Fyco1 APN 9 123828387 missense probably benign 0.00
IGL03272:Fyco1 APN 9 123829603 missense probably benign 0.00
BB009:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
BB019:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
PIT4480001:Fyco1 UTSW 9 123828650 nonsense probably null
R0013:Fyco1 UTSW 9 123822406 missense probably benign
R0025:Fyco1 UTSW 9 123829009 missense probably damaging 1.00
R0349:Fyco1 UTSW 9 123797662 missense probably damaging 0.98
R0751:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1184:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1563:Fyco1 UTSW 9 123827182 unclassified probably benign
R1618:Fyco1 UTSW 9 123829281 missense probably damaging 1.00
R1732:Fyco1 UTSW 9 123819092 missense probably benign 0.32
R1873:Fyco1 UTSW 9 123823238 missense probably benign
R1920:Fyco1 UTSW 9 123830413 missense probably damaging 1.00
R2108:Fyco1 UTSW 9 123797516 critical splice donor site probably null
R2849:Fyco1 UTSW 9 123834826 nonsense probably null
R2944:Fyco1 UTSW 9 123826648 missense probably benign 0.02
R4035:Fyco1 UTSW 9 123801283 missense probably benign 0.00
R4120:Fyco1 UTSW 9 123825626 missense probably benign 0.00
R4198:Fyco1 UTSW 9 123826634 missense probably benign
R4534:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4535:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4536:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R5408:Fyco1 UTSW 9 123829503 missense probably damaging 0.99
R5755:Fyco1 UTSW 9 123828708 missense possibly damaging 0.71
R5781:Fyco1 UTSW 9 123794833 missense probably damaging 1.00
R5813:Fyco1 UTSW 9 123831348 missense probably damaging 1.00
R7090:Fyco1 UTSW 9 123797719 missense probably damaging 0.98
R7205:Fyco1 UTSW 9 123822426 missense probably benign 0.00
R7932:Fyco1 UTSW 9 123828990 missense possibly damaging 0.79
R8086:Fyco1 UTSW 9 123830406 missense probably damaging 1.00
R8103:Fyco1 UTSW 9 123829388 missense probably benign 0.17
R8504:Fyco1 UTSW 9 123830077 missense probably benign 0.08
R8530:Fyco1 UTSW 9 123840540 critical splice donor site probably null
R8822:Fyco1 UTSW 9 123819119 missense probably damaging 1.00
Z1177:Fyco1 UTSW 9 123828323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCATGAGCAGTGAATAGAGC -3'
(R):5'- CAAGTTCTAGTCCCAGCCCTATAC -3'

Sequencing Primer
(F):5'- CAGAGGGGTCTAAATTACAGAATCAC -3'
(R):5'- CAGCTATGACGTCATTCAGAGTACTG -3'
Posted On2016-10-05