Incidental Mutation 'R5522:Unc5b'
ID431624
Institutional Source Beutler Lab
Gene Symbol Unc5b
Ensembl Gene ENSMUSG00000020099
Gene Nameunc-5 netrin receptor B
SynonymsUnc5h2, D10Bwg0792e, 6330415E02Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5522 (G1)
Quality Score150
Status Not validated
Chromosome10
Chromosomal Location60762593-60831581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60778195 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 292 (K292E)
Ref Sequence ENSEMBL: ENSMUSP00000151251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077925
AA Change: K292E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: K292E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG_like 54 149 1.71e2 SMART
IGc2 165 232 2.58e-6 SMART
TSP1 249 300 8.21e-15 SMART
TSP1 305 354 2.61e-8 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
ZU5 541 644 1.91e-56 SMART
DEATH 852 943 5.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218316
Predicted Effect possibly damaging
Transcript: ENSMUST00000218637
AA Change: K292E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Unc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Unc5b APN 10 60783216 missense possibly damaging 0.73
IGL00578:Unc5b APN 10 60767055 missense probably damaging 1.00
IGL01895:Unc5b APN 10 60767085 missense probably damaging 1.00
IGL01955:Unc5b APN 10 60778255 missense probably benign 0.30
IGL01980:Unc5b APN 10 60780187 missense probably damaging 1.00
IGL02277:Unc5b APN 10 60774742 missense probably benign
LCD18:Unc5b UTSW 10 60786171 intron probably benign
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0026:Unc5b UTSW 10 60774592 missense possibly damaging 0.86
R0147:Unc5b UTSW 10 60772297 missense probably damaging 0.96
R0305:Unc5b UTSW 10 60779658 splice site probably benign
R0306:Unc5b UTSW 10 60779658 splice site probably benign
R0373:Unc5b UTSW 10 60778940 missense possibly damaging 0.78
R0662:Unc5b UTSW 10 60772583 missense possibly damaging 0.68
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1512:Unc5b UTSW 10 60831475 unclassified probably benign
R1532:Unc5b UTSW 10 60769232 missense probably damaging 0.99
R1916:Unc5b UTSW 10 60778248 missense probably damaging 1.00
R1931:Unc5b UTSW 10 60772569 missense probably benign 0.30
R1954:Unc5b UTSW 10 60769265 splice site probably benign
R2350:Unc5b UTSW 10 60778200 missense probably benign 0.04
R3419:Unc5b UTSW 10 60778814 missense probably damaging 1.00
R4116:Unc5b UTSW 10 60774700 missense probably damaging 0.99
R4258:Unc5b UTSW 10 60765371 missense probably damaging 0.99
R4329:Unc5b UTSW 10 60783190 missense probably damaging 1.00
R4605:Unc5b UTSW 10 60774403 missense probably benign 0.01
R4828:Unc5b UTSW 10 60772348 missense possibly damaging 0.90
R5134:Unc5b UTSW 10 60775100 missense probably benign 0.09
R5190:Unc5b UTSW 10 60772293 missense probably benign 0.04
R5240:Unc5b UTSW 10 60774640 missense probably damaging 0.99
R5342:Unc5b UTSW 10 60778267 nonsense probably null
R5694:Unc5b UTSW 10 60773747 missense probably benign 0.02
R5822:Unc5b UTSW 10 60772527 missense possibly damaging 0.71
R5909:Unc5b UTSW 10 60772359 missense probably damaging 1.00
R6007:Unc5b UTSW 10 60765360 missense probably damaging 1.00
R6115:Unc5b UTSW 10 60777546 missense probably benign 0.33
R6182:Unc5b UTSW 10 60765236 missense probably damaging 1.00
R6187:Unc5b UTSW 10 60772224 missense probably damaging 1.00
R6294:Unc5b UTSW 10 60778331 missense possibly damaging 0.82
R6319:Unc5b UTSW 10 60778801 missense probably damaging 1.00
R6366:Unc5b UTSW 10 60778312 missense probably benign
R6532:Unc5b UTSW 10 60778828 missense possibly damaging 0.95
R6827:Unc5b UTSW 10 60780232 missense probably benign
R6912:Unc5b UTSW 10 60831092 missense probably benign
R7032:Unc5b UTSW 10 60778808 missense probably damaging 0.99
R7082:Unc5b UTSW 10 60775088 missense probably damaging 0.98
R7089:Unc5b UTSW 10 60777486 missense probably damaging 1.00
R7270:Unc5b UTSW 10 60772223 nonsense probably null
R7587:Unc5b UTSW 10 60783120 missense probably damaging 1.00
R7716:Unc5b UTSW 10 60777438 missense probably damaging 1.00
R7750:Unc5b UTSW 10 60775044 missense probably benign 0.00
R7810:Unc5b UTSW 10 60765241 missense probably benign
R7895:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
R7978:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
RF019:Unc5b UTSW 10 60783183 missense probably damaging 1.00
X0027:Unc5b UTSW 10 60777459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCAGGGAGCTCTCTAG -3'
(R):5'- ATGTTAATCATTTGATGGGCCATCC -3'

Sequencing Primer
(F):5'- TCTAGGACCCTGGCAGTTC -3'
(R):5'- GCCATCCCTACAGTGAATGGAG -3'
Posted On2016-10-05