Incidental Mutation 'R5522:Olfr781'
ID431626
Institutional Source Beutler Lab
Gene Symbol Olfr781
Ensembl Gene ENSMUSG00000095138
Gene Nameolfactory receptor 781
SynonymsGA_x6K02T2PULF-11013616-11014551, MOR114-6
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129328854-129333844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129332929 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 16 (D16V)
Ref Sequence ENSEMBL: ENSMUSP00000145356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075613] [ENSMUST00000204108]
Predicted Effect probably damaging
Transcript: ENSMUST00000075613
AA Change: D16V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075041
Gene: ENSMUSG00000095138
AA Change: D16V

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.6e-44 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204108
AA Change: D16V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145356
Gene: ENSMUSG00000095138
AA Change: D16V

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.6e-44 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Olfr781
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Olfr781 APN 10 129332935 missense probably benign
IGL01636:Olfr781 APN 10 129332883 start codon destroyed probably damaging 0.96
IGL01744:Olfr781 APN 10 129333457 missense probably benign 0.05
IGL01867:Olfr781 APN 10 129333363 missense probably damaging 1.00
IGL02002:Olfr781 APN 10 129333127 missense probably damaging 0.99
IGL02423:Olfr781 APN 10 129333528 missense probably benign 0.00
R2036:Olfr781 UTSW 10 129333672 missense probably benign 0.43
R2099:Olfr781 UTSW 10 129333283 missense probably damaging 0.96
R2273:Olfr781 UTSW 10 129333457 missense probably benign 0.05
R2274:Olfr781 UTSW 10 129333457 missense probably benign 0.05
R3841:Olfr781 UTSW 10 129333333 missense probably benign 0.00
R4585:Olfr781 UTSW 10 129333273 missense probably benign 0.08
R4586:Olfr781 UTSW 10 129333273 missense probably benign 0.08
R6052:Olfr781 UTSW 10 129333202 missense possibly damaging 0.91
R6414:Olfr781 UTSW 10 129333709 missense probably benign 0.23
R6468:Olfr781 UTSW 10 129333711 missense possibly damaging 0.91
R6647:Olfr781 UTSW 10 129333164 nonsense probably null
R8099:Olfr781 UTSW 10 129333127 missense probably damaging 0.99
T0975:Olfr781 UTSW 10 129333445 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AACCAATGGTAATACAGCGATGAC -3'
(R):5'- ATAGGTAATGGACTTGTCCCCAG -3'

Sequencing Primer
(F):5'- TACAGCGATGACACTCAAGTTAG -3'
(R):5'- ATGGACTTGTCCCCAGATGATATGC -3'
Posted On2016-10-05