Incidental Mutation 'R5522:Grb10'
ID431627
Institutional Source Beutler Lab
Gene Symbol Grb10
Ensembl Gene ENSMUSG00000020176
Gene Namegrowth factor receptor bound protein 10
Synonyms5730571D09Rik, maternally expressed gene 1, Meg1
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R5522 (G1)
Quality Score198
Status Not validated
Chromosome11
Chromosomal Location11930508-12038683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11936746 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 508 (I508V)
Ref Sequence ENSEMBL: ENSMUSP00000091011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093321] [ENSMUST00000109653] [ENSMUST00000109654]
Predicted Effect probably benign
Transcript: ENSMUST00000093321
AA Change: I508V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091011
Gene: ENSMUSG00000020176
AA Change: I508V

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
PH 294 404 7.13e-10 SMART
Pfam:BPS 427 473 6.4e-31 PFAM
SH2 493 582 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109653
AA Change: I462V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105280
Gene: ENSMUSG00000020176
AA Change: I462V

DomainStartEndE-ValueType
low complexity region 92 119 N/A INTRINSIC
RA 169 253 2.56e-20 SMART
Blast:PH 285 358 1e-44 BLAST
Pfam:BPS 381 428 3.5e-33 PFAM
SH2 447 536 7.78e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109654
AA Change: I453V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105281
Gene: ENSMUSG00000020176
AA Change: I453V

DomainStartEndE-ValueType
RA 114 198 5.45e-24 SMART
PH 239 349 7.13e-10 SMART
Pfam:BPS 372 419 5.4e-33 PFAM
SH2 438 527 7.78e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124587
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
PHENOTYPE: Maternal transmission of a mutant allele results in both fetal and placental overgrowth. Disproportionate overgrowth of the liver is observed. Paternal transmission of an allele lacking the differentially methylated region results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Grb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Grb10 APN 11 11945599 missense probably damaging 1.00
IGL01450:Grb10 APN 11 11970432 missense probably damaging 1.00
IGL01872:Grb10 APN 11 11970547 missense probably damaging 0.99
IGL02164:Grb10 APN 11 11943962 missense probably damaging 1.00
IGL02508:Grb10 APN 11 11946767 missense probably damaging 1.00
IGL02626:Grb10 APN 11 11945503 missense probably benign 0.00
IGL03275:Grb10 APN 11 11933591 missense possibly damaging 0.46
virginia UTSW 11 11933551 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0042:Grb10 UTSW 11 11936798 missense probably damaging 1.00
R0089:Grb10 UTSW 11 11934192 splice site probably benign
R0196:Grb10 UTSW 11 11945583 missense probably damaging 1.00
R0419:Grb10 UTSW 11 11934207 missense possibly damaging 0.87
R0645:Grb10 UTSW 11 11936755 missense probably damaging 0.98
R1473:Grb10 UTSW 11 11934249 missense probably damaging 1.00
R1848:Grb10 UTSW 11 11946029 missense possibly damaging 0.78
R2025:Grb10 UTSW 11 11970576 nonsense probably null
R4455:Grb10 UTSW 11 11967665 missense possibly damaging 0.93
R4857:Grb10 UTSW 11 11951469 unclassified probably benign
R5289:Grb10 UTSW 11 11944924 splice site silent
R5696:Grb10 UTSW 11 11933566 missense probably benign 0.23
R6119:Grb10 UTSW 11 11933551 missense probably damaging 1.00
R6163:Grb10 UTSW 11 11943932 nonsense probably null
R6267:Grb10 UTSW 11 11970639 start gained probably benign
R6328:Grb10 UTSW 11 11937905 missense probably damaging 1.00
R6741:Grb10 UTSW 11 11936717 critical splice donor site probably null
R7610:Grb10 UTSW 11 11943955 missense probably benign 0.33
R7641:Grb10 UTSW 11 11933492 missense possibly damaging 0.84
R8209:Grb10 UTSW 11 11951533 missense probably damaging 0.99
R8226:Grb10 UTSW 11 11951533 missense probably damaging 0.99
R8916:Grb10 UTSW 11 11951599
Z1176:Grb10 UTSW 11 11944845 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AAGGCCATCATACGTTGCCTC -3'
(R):5'- TCTGGGCCTCTCTAAGTTGTGC -3'

Sequencing Primer
(F):5'- ATACGTTGCCTCTGAGCTGCAG -3'
(R):5'- GGCCTCTCTAAGTTGTGCATAATGC -3'
Posted On2016-10-05