Incidental Mutation 'R5522:Pbrm1'
ID431635
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Namepolybromo 1
SynonymsBAF180, Pb1, 2610016F04Rik, 2310032M22Rik
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31019138-31121592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31089563 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1210 (Y1210C)
Ref Sequence ENSEMBL: ENSMUSP00000123546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000064032] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000123678] [ENSMUST00000135704] [ENSMUST00000136237] [ENSMUST00000156628] [ENSMUST00000203261]
Predicted Effect probably damaging
Transcript: ENSMUST00000022471
AA Change: Y1211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323
AA Change: Y1211C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022474
AA Change: Y1226C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323
AA Change: Y1226C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052239
AA Change: Y1186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323
AA Change: Y1186C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064032
SMART Domains Protein: ENSMUSP00000067418
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090214
AA Change: Y1211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323
AA Change: Y1211C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112092
AA Change: Y1226C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323
AA Change: Y1226C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112094
AA Change: Y1179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323
AA Change: Y1179C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112095
AA Change: Y1211C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323
AA Change: Y1211C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112098
AA Change: Y1226C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323
AA Change: Y1226C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123678
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135704
SMART Domains Protein: ENSMUSP00000115505
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 1 97 3.24e-25 SMART
BROMO 119 233 5.84e-41 SMART
low complexity region 298 314 N/A INTRINSIC
BROMO 323 433 1.57e-32 SMART
BROMO 475 586 6.07e-39 SMART
BROMO 610 724 3.01e-43 SMART
BROMO 734 840 2.53e-18 SMART
low complexity region 862 892 N/A INTRINSIC
BAH 914 1032 1.33e-45 SMART
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136237
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156407
Predicted Effect probably damaging
Transcript: ENSMUST00000156628
AA Change: Y1210C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323
AA Change: Y1210C

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203261
SMART Domains Protein: ENSMUSP00000145018
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 31030927 missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 31052283 missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 31032404 splice site probably benign
IGL00674:Pbrm1 APN 14 31118776 missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 31052248 missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 31087619 missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 31052260 missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 31082604 missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 31089616 missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 31032510 missense probably benign 0.00
IGL02675:Pbrm1 APN 14 31106287 missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 31061513 missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 31067804 missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 31061551 missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 31110549 missense probably benign 0.00
IGL03290:Pbrm1 APN 14 31107284 missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 31085019 missense probably benign 0.04
IGL03386:Pbrm1 APN 14 31050092 missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 31067861 missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R0552:Pbrm1 UTSW 14 31035959 missense probably damaging 1.00
R0558:Pbrm1 UTSW 14 31085059 splice site probably null
R0561:Pbrm1 UTSW 14 31035991 missense probably benign
R0591:Pbrm1 UTSW 14 31046430 splice site probably benign
R0835:Pbrm1 UTSW 14 31067579 missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 31050142 missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 31118852 missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 31074814 missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 31067502 missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 31032548 missense probably benign 0.07
R1843:Pbrm1 UTSW 14 31038957 missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 31106175 missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 31074893 missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 31032475 missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 31036003 missense probably benign 0.00
R4280:Pbrm1 UTSW 14 31107312 critical splice donor site probably null
R4379:Pbrm1 UTSW 14 31067706 missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 31025556 missense probably benign 0.02
R4816:Pbrm1 UTSW 14 31110448 missense probably benign 0.32
R4939:Pbrm1 UTSW 14 31061623 missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 31052216 missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 31074827 missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 31032530 missense probably benign 0.00
R5276:Pbrm1 UTSW 14 31106184 missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 31082610 missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 31085011 missense probably damaging 0.96
R5476:Pbrm1 UTSW 14 31032519 missense probably benign 0.00
R5548:Pbrm1 UTSW 14 31105424 missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 31035992 missense probably benign 0.20
R6089:Pbrm1 UTSW 14 31087585 missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 31052283 missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 31050111 missense probably benign 0.19
R6335:Pbrm1 UTSW 14 31084095 missense probably damaging 1.00
R6499:Pbrm1 UTSW 14 31061509 missense probably damaging 0.99
R6823:Pbrm1 UTSW 14 31084790 missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R7021:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R7216:Pbrm1 UTSW 14 31045422 missense possibly damaging 0.93
R7588:Pbrm1 UTSW 14 31084943 missense probably damaging 0.99
R7828:Pbrm1 UTSW 14 31030891 missense probably damaging 1.00
R8035:Pbrm1 UTSW 14 31084152 missense probably damaging 1.00
R8188:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R8417:Pbrm1 UTSW 14 31027462 missense possibly damaging 0.92
R8517:Pbrm1 UTSW 14 31067782 missense probably benign 0.00
Z1088:Pbrm1 UTSW 14 31110454 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTGAGGAGAATCCATGAAATTTCTC -3'
(R):5'- TTTGGCTGATCATGTGACCTC -3'

Sequencing Primer
(F):5'- GAGCTGATTCCCACTTCTAATGGAG -3'
(R):5'- GGCTGATCATGTGACCTCATCTAAAC -3'
Posted On2016-10-05