Incidental Mutation 'R5522:Mchr1'
ID431636
Institutional Source Beutler Lab
Gene Symbol Mchr1
Ensembl Gene ENSMUSG00000050164
Gene Namemelanin-concentrating hormone receptor 1
Synonymsmelanin-concentrating hormone receptor 1, Gpr24-9, Gpr24, Mch1r, MCH-1R
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5522 (G1)
Quality Score124
Status Not validated
Chromosome15
Chromosomal Location81235499-81238964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81238010 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 320 (K320N)
Ref Sequence ENSEMBL: ENSMUSP00000126191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166855
AA Change: K320N

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126191
Gene: ENSMUSG00000050164
AA Change: K320N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 184 4e-6 PFAM
Pfam:7TM_GPCR_Srsx 51 325 3.6e-10 PFAM
Pfam:7tm_1 57 311 2.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230860
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for some alleles may display osteoporosis, resistance to diet-induced obesity, abnormal pyramidal neuron physiology, hyperactivity, polyphagia, increased heart rate and body temperature, sleep behavior, and impaired conditioned learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Pcdhb6 A G 18: 37,334,349 I108V probably benign Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Mchr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01834:Mchr1 APN 15 81237865 missense probably damaging 1.00
IGL02364:Mchr1 APN 15 81237279 missense probably benign 0.36
Ketogenic UTSW 15 81237868 missense probably damaging 1.00
PIT4366001:Mchr1 UTSW 15 81237216 missense probably benign 0.01
R0412:Mchr1 UTSW 15 81235747 start gained probably benign
R1554:Mchr1 UTSW 15 81235820 missense probably benign 0.02
R1706:Mchr1 UTSW 15 81237163 missense probably damaging 0.99
R1771:Mchr1 UTSW 15 81237235 missense probably damaging 1.00
R5930:Mchr1 UTSW 15 81237843 missense probably damaging 1.00
R6516:Mchr1 UTSW 15 81237868 missense probably damaging 1.00
R6612:Mchr1 UTSW 15 81237870 missense probably damaging 0.99
R6978:Mchr1 UTSW 15 81237796 missense possibly damaging 0.90
R7583:Mchr1 UTSW 15 81237441 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGCCATTGCCATCTGTCTGG -3'
(R):5'- GAATGTGGTTTGCTACAAGCC -3'

Sequencing Primer
(F):5'- GCCATCTGTCTGGTCTTCTTTGTG -3'
(R):5'- TGGTTTGCTACAAGCCCCCAG -3'
Posted On2016-10-05