Incidental Mutation 'R5522:Pcdhb6'
ID431641
Institutional Source Beutler Lab
Gene Symbol Pcdhb6
Ensembl Gene ENSMUSG00000051678
Gene Nameprotocadherin beta 6
SynonymsPcdhb5B, PcdhbF
MMRRC Submission 043081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5522 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37333921-37337674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37334349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 108 (I108V)
Ref Sequence ENSEMBL: ENSMUSP00000058592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544] [ENSMUST00000194655]
Predicted Effect probably benign
Transcript: ENSMUST00000061717
AA Change: I108V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678
AA Change: I108V

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194655
SMART Domains Protein: ENSMUSP00000141773
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Blast:CA 1 60 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.4%
  • 10x: 93.9%
  • 20x: 85.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,302 probably benign Het
Adgrl1 T C 8: 83,923,075 Y121H possibly damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Atp13a2 T A 4: 141,004,360 probably null Het
Cd69 A T 6: 129,271,416 S36T probably damaging Het
Ceacam5 A T 7: 17,715,080 I124L probably benign Het
Cerkl T C 2: 79,392,984 H131R probably benign Het
Cfap57 A T 4: 118,595,888 N539K probably benign Het
Cyp4x1 C A 4: 115,121,977 W141L probably damaging Het
Dlgap1 T C 17: 70,516,998 probably null Het
Dst T C 1: 34,257,873 I5781T possibly damaging Het
Epha2 T A 4: 141,308,556 V101E probably damaging Het
Exph5 T C 9: 53,374,313 F898S possibly damaging Het
Fyco1 G A 9: 123,794,771 R1398* probably null Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grb10 T C 11: 11,936,746 I508V probably benign Het
Igf1r C A 7: 68,183,510 Q473K probably damaging Het
Ighv1-66 T A 12: 115,593,135 D109V probably damaging Het
Ipmk C A 10: 71,363,474 T55K probably benign Het
Kdm2b A G 5: 122,949,162 Y192H probably damaging Het
Krt32 A T 11: 100,086,671 probably null Het
Kti12 T A 4: 108,848,423 L178Q possibly damaging Het
Mchr1 A T 15: 81,238,010 K320N possibly damaging Het
Mdn1 T C 4: 32,685,783 L858S probably damaging Het
Myo3a T A 2: 22,574,341 F198Y probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfatc1 T C 18: 80,653,529 T647A probably benign Het
Nuf2 A G 1: 169,498,884 Y433H probably damaging Het
Nup210l T C 3: 90,154,665 V717A probably benign Het
Olfr183 A T 16: 58,999,905 L73F probably benign Het
Olfr401 A G 11: 74,121,658 Y123C probably damaging Het
Olfr781 A T 10: 129,332,929 D16V probably damaging Het
Pbrm1 A G 14: 31,089,563 Y1210C probably damaging Het
Plac8 T A 5: 100,562,718 T6S probably benign Het
Plbd1 A T 6: 136,617,300 V317E probably benign Het
Rars A T 11: 35,817,368 Y406* probably null Het
Scamp3 T C 3: 89,177,622 F11L possibly damaging Het
Sctr A G 1: 120,036,416 N142S probably benign Het
Sh2d4a T C 8: 68,296,697 S128P probably benign Het
Snrnp70 C T 7: 45,377,177 probably benign Het
Taf3 T C 2: 9,941,005 K596R probably damaging Het
Tango6 T C 8: 106,695,598 probably null Het
Taok3 A G 5: 117,273,757 T414A probably benign Het
Tmem104 G A 11: 115,188,323 probably null Het
Tmem231 T A 8: 111,918,410 S155C possibly damaging Het
Tssk3 G A 4: 129,489,550 R110W possibly damaging Het
Ugt2b37 T C 5: 87,240,900 T485A probably benign Het
Unc5b T C 10: 60,778,195 K292E possibly damaging Het
Upf3a T A 8: 13,795,497 probably null Het
Usp24 T A 4: 106,372,721 V797E probably damaging Het
Vcan T C 13: 89,691,810 T1872A possibly damaging Het
Vmn1r195 A G 13: 22,278,950 M197V probably damaging Het
Vmn2r40 T A 7: 8,908,204 T697S probably benign Het
Xab2 A T 8: 3,611,718 D578E probably benign Het
Xpo7 A T 14: 70,671,650 Y810* probably null Het
Zcchc2 A G 1: 106,023,696 N587S probably benign Het
Zfp189 C T 4: 49,529,739 R281* probably null Het
Zranb1 T C 7: 132,983,949 *735R probably null Het
Other mutations in Pcdhb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pcdhb6 APN 18 37334224 missense probably damaging 1.00
IGL02123:Pcdhb6 APN 18 37335820 missense probably damaging 1.00
IGL02491:Pcdhb6 APN 18 37335682 missense probably damaging 1.00
IGL02496:Pcdhb6 APN 18 37335454 missense probably damaging 1.00
IGL02608:Pcdhb6 APN 18 37334694 missense probably damaging 0.99
IGL03130:Pcdhb6 APN 18 37335587 nonsense probably null
IGL03144:Pcdhb6 APN 18 37334406 missense probably damaging 1.00
IGL03189:Pcdhb6 APN 18 37336152 missense probably damaging 0.98
IGL03203:Pcdhb6 APN 18 37334532 missense possibly damaging 0.95
IGL03388:Pcdhb6 APN 18 37336137 missense probably damaging 0.99
PIT4445001:Pcdhb6 UTSW 18 37335247 missense possibly damaging 0.67
R0571:Pcdhb6 UTSW 18 37335114 missense probably benign 0.01
R0734:Pcdhb6 UTSW 18 37335334 missense probably damaging 0.99
R1727:Pcdhb6 UTSW 18 37334587 missense probably damaging 1.00
R2206:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2207:Pcdhb6 UTSW 18 37335580 missense probably benign 0.10
R2303:Pcdhb6 UTSW 18 37336231 missense probably damaging 1.00
R2401:Pcdhb6 UTSW 18 37335169 missense probably benign 0.35
R3409:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3411:Pcdhb6 UTSW 18 37335892 missense probably damaging 1.00
R3625:Pcdhb6 UTSW 18 37336140 missense probably damaging 1.00
R3716:Pcdhb6 UTSW 18 37336206 missense probably benign 0.01
R4745:Pcdhb6 UTSW 18 37335373 missense possibly damaging 0.86
R4821:Pcdhb6 UTSW 18 37334328 missense probably damaging 1.00
R5218:Pcdhb6 UTSW 18 37334335 missense possibly damaging 0.95
R5465:Pcdhb6 UTSW 18 37334730 missense probably damaging 0.97
R5556:Pcdhb6 UTSW 18 37334389 missense probably damaging 1.00
R5703:Pcdhb6 UTSW 18 37334700 missense probably benign 0.15
R6154:Pcdhb6 UTSW 18 37334913 missense probably benign 0.00
R6256:Pcdhb6 UTSW 18 37335925 missense probably damaging 0.98
R6304:Pcdhb6 UTSW 18 37335921 nonsense probably null
R6528:Pcdhb6 UTSW 18 37334503 missense probably damaging 1.00
R6883:Pcdhb6 UTSW 18 37335145 missense probably damaging 1.00
R7045:Pcdhb6 UTSW 18 37336276 missense possibly damaging 0.88
R7307:Pcdhb6 UTSW 18 37335478 missense probably benign
R7313:Pcdhb6 UTSW 18 37335208 missense probably damaging 0.99
R7378:Pcdhb6 UTSW 18 37335172 missense probably damaging 1.00
R7555:Pcdhb6 UTSW 18 37335279 missense possibly damaging 0.60
R7606:Pcdhb6 UTSW 18 37335606 missense probably damaging 0.99
R7701:Pcdhb6 UTSW 18 37334509 missense probably damaging 1.00
R7830:Pcdhb6 UTSW 18 37336312 missense probably benign 0.05
R7905:Pcdhb6 UTSW 18 37334554 missense probably benign 0.00
R7982:Pcdhb6 UTSW 18 37334220 nonsense probably null
R8818:Pcdhb6 UTSW 18 37335784 missense probably benign 0.06
Z1088:Pcdhb6 UTSW 18 37335146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGAGAGTGGCTACTTGGTG -3'
(R):5'- GACTGTGTAGTTCTGAACAGCG -3'

Sequencing Primer
(F):5'- TGGCTCACTTGGCAAAAGATCTG -3'
(R):5'- GAACAGCGTTGCTTCCAATG -3'
Posted On2016-10-05