Incidental Mutation 'R5523:Plcb1'
ID431648
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission 043265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R5523 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 135260566 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 221 (P221H)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: P221H

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: P221H

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: P221H

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: P221H

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129382
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: P221H

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: P221H

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201485
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,938,636 T70M probably benign Het
Adamtsl3 G A 7: 82,574,442 A218T possibly damaging Het
Ahnak2 T C 12: 112,775,208 D810G probably damaging Het
Ak7 T A 12: 105,741,082 L315* probably null Het
Apoa5 T C 9: 46,270,589 F321S possibly damaging Het
Baiap2l1 G C 5: 144,275,958 P416A probably damaging Het
Bco1 A G 8: 117,108,693 I128V possibly damaging Het
Bpifb2 T C 2: 153,875,985 probably benign Het
Cdt1 G A 8: 122,568,093 R13H possibly damaging Het
Cenpj A G 14: 56,552,423 V723A probably benign Het
Chl1 T A 6: 103,708,714 W849R probably damaging Het
Cpne9 A G 6: 113,290,231 D169G probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp4f39 C A 17: 32,470,833 N84K probably benign Het
Cyp4f40 T A 17: 32,669,822 F192I probably damaging Het
Disp3 T C 4: 148,258,097 D632G probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Echs1 G T 7: 140,112,513 T107K probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Ergic1 G A 17: 26,624,606 V17I probably damaging Het
Fank1 G T 7: 133,876,840 C210F probably damaging Het
Fbxo15 T G 18: 84,960,069 M136R probably damaging Het
Ggcx C A 6: 72,424,034 P240H probably damaging Het
Gpr179 T C 11: 97,336,782 R1516G probably benign Het
Gprin3 G A 6: 59,353,946 Q459* probably null Het
Hadha C A 5: 30,145,254 V99F possibly damaging Het
Hirip3 A G 7: 126,863,862 D330G possibly damaging Het
Irx2 T C 13: 72,631,595 W333R probably damaging Het
Kansl1l T C 1: 66,802,112 T10A probably benign Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Klc3 A T 7: 19,397,007 I215N probably damaging Het
Kmt2c A G 5: 25,299,339 V3657A probably benign Het
Lin28b A T 10: 45,469,068 L54* probably null Het
Mgll T C 6: 88,725,761 V14A probably benign Het
Mrc2 A G 11: 105,343,582 N976S probably benign Het
Myh8 C A 11: 67,305,962 A1807E possibly damaging Het
Nalcn G A 14: 123,409,743 P573S probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Neb T C 2: 52,278,815 S1903G probably benign Het
Nfe2 T A 15: 103,249,129 D145V probably damaging Het
Olfr243 T A 7: 103,717,480 Y295* probably null Het
Padi1 A T 4: 140,814,853 V586D probably damaging Het
Pcdh12 T C 18: 38,283,139 D311G probably damaging Het
Pcdha11 A T 18: 37,012,386 H510L probably damaging Het
Plekhg2 A T 7: 28,370,431 V58E probably damaging Het
Pparg A C 6: 115,490,071 Q435P probably damaging Het
Ppp1r36 A G 12: 76,438,118 T282A possibly damaging Het
Prcd T C 11: 116,668,284 probably benign Het
Pygo1 A T 9: 72,944,984 H151L possibly damaging Het
Rnmt A G 18: 68,313,702 Y266C probably benign Het
Rxrb T C 17: 34,036,437 V246A probably damaging Het
Sart1 A G 19: 5,383,676 S378P probably damaging Het
Sema4d T C 13: 51,711,354 N318S possibly damaging Het
Sis C T 3: 72,891,421 V1765I probably benign Het
Slc17a6 A T 7: 51,626,850 K116* probably null Het
Smc6 T A 12: 11,291,539 H519Q probably benign Het
Sowahc T A 10: 59,222,963 M307K probably benign Het
Sptbn1 A G 11: 30,137,560 Y960H probably damaging Het
Tmem270 A C 5: 134,902,782 V102G probably benign Het
Tmprss11d A G 5: 86,338,870 F54L probably benign Het
Top1 T A 2: 160,702,775 Y270* probably null Het
Trpm2 A G 10: 77,935,961 F615L probably benign Het
Ttf2 A G 3: 100,959,242 S525P probably damaging Het
Ttn A T 2: 76,946,897 M1387K possibly damaging Het
Upk3bl A T 5: 136,060,100 R156W probably damaging Het
Usp34 G T 11: 23,349,198 R290L probably benign Het
Vwf T C 6: 125,643,042 V1561A Het
Zan A G 5: 137,421,893 I2834T unknown Het
Zfp105 A G 9: 122,926,389 Y90C probably benign Het
Zfp804a T C 2: 82,258,995 V1056A probably damaging Het
Zfp956 A T 6: 47,953,521 probably benign Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
R8439:Plcb1 UTSW 2 135250052 critical splice donor site probably null
R8549:Plcb1 UTSW 2 135364933 missense probably benign 0.00
R8693:Plcb1 UTSW 2 135252776 missense probably benign 0.00
R8750:Plcb1 UTSW 2 135335449 missense probably damaging 1.00
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGGCCTCAGAGGTGTTCTC -3'
(R):5'- AAGGCCAGTAGCAGATTGTCAC -3'

Sequencing Primer
(F):5'- CCTTGGACTGGTTTGGCAAAAAG -3'
(R):5'- AGTAGCAGATTGTCACCTCCTTCAAG -3'
Posted On2016-10-05