Incidental Mutation 'R5523:Sis'
ID 431651
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Name sucrase isomaltase
Synonyms 2010204N08Rik, Si-s, sucrase-isomaltase
MMRRC Submission 043265-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5523 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 72795890-72875196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72798754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1765 (V1765I)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
AlphaFold F8VQM5
Predicted Effect probably benign
Transcript: ENSMUST00000094190
AA Change: V1765I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: V1765I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167334
AA Change: V1765I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: V1765I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,644,273 (GRCm39) T70M probably benign Het
Adamtsl3 G A 7: 82,223,650 (GRCm39) A218T possibly damaging Het
Ahnak2 T C 12: 112,741,642 (GRCm39) D810G probably damaging Het
Ak7 T A 12: 105,707,341 (GRCm39) L315* probably null Het
Apoa5 T C 9: 46,181,887 (GRCm39) F321S possibly damaging Het
Baiap2l1 G C 5: 144,212,768 (GRCm39) P416A probably damaging Het
Bco1 A G 8: 117,835,432 (GRCm39) I128V possibly damaging Het
Bpifb2 T C 2: 153,717,905 (GRCm39) probably benign Het
Cdt1 G A 8: 123,294,832 (GRCm39) R13H possibly damaging Het
Cenpj A G 14: 56,789,880 (GRCm39) V723A probably benign Het
Chl1 T A 6: 103,685,675 (GRCm39) W849R probably damaging Het
Cpne9 A G 6: 113,267,192 (GRCm39) D169G probably damaging Het
Cyp2d22 A G 15: 82,256,772 (GRCm39) V334A probably damaging Het
Cyp4f39 C A 17: 32,689,807 (GRCm39) N84K probably benign Het
Cyp4f40 T A 17: 32,888,796 (GRCm39) F192I probably damaging Het
Disp3 T C 4: 148,342,554 (GRCm39) D632G probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Echs1 G T 7: 139,692,426 (GRCm39) T107K probably benign Het
Ehmt2 C T 17: 35,118,067 (GRCm39) R40* probably null Het
Ergic1 G A 17: 26,843,580 (GRCm39) V17I probably damaging Het
Fank1 G T 7: 133,478,569 (GRCm39) C210F probably damaging Het
Fbxo15 T G 18: 84,978,194 (GRCm39) M136R probably damaging Het
Ggcx C A 6: 72,401,017 (GRCm39) P240H probably damaging Het
Gpr179 T C 11: 97,227,608 (GRCm39) R1516G probably benign Het
Gprin3 G A 6: 59,330,931 (GRCm39) Q459* probably null Het
Hadha C A 5: 30,350,252 (GRCm39) V99F possibly damaging Het
Hirip3 A G 7: 126,463,034 (GRCm39) D330G possibly damaging Het
Irx2 T C 13: 72,779,714 (GRCm39) W333R probably damaging Het
Kansl1l T C 1: 66,841,271 (GRCm39) T10A probably benign Het
Kcnd2 T C 6: 21,723,211 (GRCm39) I467T probably benign Het
Klc3 A T 7: 19,130,932 (GRCm39) I215N probably damaging Het
Kmt2c A G 5: 25,504,337 (GRCm39) V3657A probably benign Het
Lin28b A T 10: 45,345,164 (GRCm39) L54* probably null Het
Mgll T C 6: 88,702,743 (GRCm39) V14A probably benign Het
Mrc2 A G 11: 105,234,408 (GRCm39) N976S probably benign Het
Myh8 C A 11: 67,196,788 (GRCm39) A1807E possibly damaging Het
Nalcn G A 14: 123,647,155 (GRCm39) P573S probably damaging Het
Ncam2 C T 16: 81,231,766 (GRCm39) R77* probably null Het
Neb T C 2: 52,168,827 (GRCm39) S1903G probably benign Het
Nfe2 T A 15: 103,157,556 (GRCm39) D145V probably damaging Het
Or52a20 T A 7: 103,366,687 (GRCm39) Y295* probably null Het
Padi1 A T 4: 140,542,164 (GRCm39) V586D probably damaging Het
Pcdh12 T C 18: 38,416,192 (GRCm39) D311G probably damaging Het
Pcdha11 A T 18: 37,145,439 (GRCm39) H510L probably damaging Het
Plcb1 C A 2: 135,102,486 (GRCm39) P221H probably benign Het
Plekhg2 A T 7: 28,069,856 (GRCm39) V58E probably damaging Het
Pparg A C 6: 115,467,032 (GRCm39) Q435P probably damaging Het
Ppp1r36 A G 12: 76,484,892 (GRCm39) T282A possibly damaging Het
Prcd T C 11: 116,559,110 (GRCm39) probably benign Het
Pygo1 A T 9: 72,852,266 (GRCm39) H151L possibly damaging Het
Rnmt A G 18: 68,446,773 (GRCm39) Y266C probably benign Het
Rxrb T C 17: 34,255,411 (GRCm39) V246A probably damaging Het
Sart1 A G 19: 5,433,704 (GRCm39) S378P probably damaging Het
Sema4d T C 13: 51,865,390 (GRCm39) N318S possibly damaging Het
Slc17a6 A T 7: 51,276,598 (GRCm39) K116* probably null Het
Smc6 T A 12: 11,341,540 (GRCm39) H519Q probably benign Het
Sowahc T A 10: 59,058,785 (GRCm39) M307K probably benign Het
Sptbn1 A G 11: 30,087,560 (GRCm39) Y960H probably damaging Het
Tmem270 A C 5: 134,931,636 (GRCm39) V102G probably benign Het
Tmprss11d A G 5: 86,486,729 (GRCm39) F54L probably benign Het
Top1 T A 2: 160,544,695 (GRCm39) Y270* probably null Het
Trpm2 A G 10: 77,771,795 (GRCm39) F615L probably benign Het
Ttf2 A G 3: 100,866,558 (GRCm39) S525P probably damaging Het
Ttn A T 2: 76,777,241 (GRCm39) M1387K possibly damaging Het
Upk3bl A T 5: 136,088,954 (GRCm39) R156W probably damaging Het
Usp34 G T 11: 23,299,198 (GRCm39) R290L probably benign Het
Vwf T C 6: 125,620,005 (GRCm39) V1561A Het
Zan A G 5: 137,420,155 (GRCm39) I2834T unknown Het
Zfp105 A G 9: 122,755,454 (GRCm39) Y90C probably benign Het
Zfp804a T C 2: 82,089,339 (GRCm39) V1056A probably damaging Het
Zfp956 A T 6: 47,930,455 (GRCm39) probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72,853,969 (GRCm39) missense probably benign
IGL00715:Sis APN 3 72,841,457 (GRCm39) missense probably damaging 1.00
IGL00721:Sis APN 3 72,850,912 (GRCm39) missense probably damaging 1.00
IGL00766:Sis APN 3 72,814,570 (GRCm39) splice site probably benign
IGL00783:Sis APN 3 72,853,965 (GRCm39) missense probably benign
IGL00805:Sis APN 3 72,841,532 (GRCm39) missense probably benign 0.05
IGL00932:Sis APN 3 72,848,289 (GRCm39) splice site probably benign
IGL01020:Sis APN 3 72,874,171 (GRCm39) missense probably damaging 1.00
IGL01024:Sis APN 3 72,819,209 (GRCm39) missense probably damaging 1.00
IGL01286:Sis APN 3 72,848,358 (GRCm39) missense probably damaging 1.00
IGL01457:Sis APN 3 72,868,354 (GRCm39) missense probably benign
IGL01514:Sis APN 3 72,843,253 (GRCm39) splice site probably benign
IGL01986:Sis APN 3 72,852,545 (GRCm39) missense probably damaging 1.00
IGL02110:Sis APN 3 72,836,032 (GRCm39) nonsense probably null
IGL02132:Sis APN 3 72,854,804 (GRCm39) missense probably benign 0.00
IGL02152:Sis APN 3 72,796,319 (GRCm39) utr 3 prime probably benign
IGL02200:Sis APN 3 72,850,937 (GRCm39) missense probably damaging 0.99
IGL02244:Sis APN 3 72,863,523 (GRCm39) missense probably benign 0.19
IGL02307:Sis APN 3 72,819,167 (GRCm39) splice site probably benign
IGL02374:Sis APN 3 72,832,789 (GRCm39) missense probably benign 0.03
IGL02437:Sis APN 3 72,826,947 (GRCm39) critical splice acceptor site probably null
IGL02571:Sis APN 3 72,863,637 (GRCm39) splice site probably benign
IGL02601:Sis APN 3 72,820,543 (GRCm39) missense probably benign 0.44
IGL03063:Sis APN 3 72,835,630 (GRCm39) missense probably benign
IGL03382:Sis APN 3 72,836,052 (GRCm39) missense probably benign 0.00
IGL03397:Sis APN 3 72,843,212 (GRCm39) missense probably benign 0.44
PIT1430001:Sis UTSW 3 72,830,162 (GRCm39) missense probably damaging 0.97
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0046:Sis UTSW 3 72,839,427 (GRCm39) missense probably benign 0.01
R0094:Sis UTSW 3 72,828,770 (GRCm39) missense probably damaging 1.00
R0096:Sis UTSW 3 72,835,600 (GRCm39) missense probably damaging 1.00
R0505:Sis UTSW 3 72,867,629 (GRCm39) missense probably benign 0.29
R0544:Sis UTSW 3 72,858,975 (GRCm39) missense probably damaging 1.00
R0551:Sis UTSW 3 72,832,740 (GRCm39) missense possibly damaging 0.79
R0617:Sis UTSW 3 72,872,938 (GRCm39) missense probably damaging 1.00
R0698:Sis UTSW 3 72,817,831 (GRCm39) missense probably damaging 1.00
R0701:Sis UTSW 3 72,848,378 (GRCm39) missense probably damaging 1.00
R0704:Sis UTSW 3 72,857,155 (GRCm39) missense possibly damaging 0.63
R0706:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0710:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0752:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0753:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0754:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0767:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0769:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0772:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0774:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0776:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0818:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0819:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0885:Sis UTSW 3 72,819,282 (GRCm39) nonsense probably null
R1076:Sis UTSW 3 72,841,431 (GRCm39) missense probably damaging 0.97
R1140:Sis UTSW 3 72,858,949 (GRCm39) missense probably damaging 0.98
R1175:Sis UTSW 3 72,865,437 (GRCm39) splice site probably benign
R1301:Sis UTSW 3 72,853,915 (GRCm39) missense possibly damaging 0.76
R1437:Sis UTSW 3 72,841,475 (GRCm39) missense probably damaging 1.00
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1472:Sis UTSW 3 72,796,360 (GRCm39) missense probably benign 0.12
R1584:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1707:Sis UTSW 3 72,816,420 (GRCm39) splice site probably benign
R1715:Sis UTSW 3 72,796,343 (GRCm39) missense possibly damaging 0.47
R1719:Sis UTSW 3 72,872,937 (GRCm39) missense probably damaging 1.00
R1728:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1784:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1820:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R1972:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R1973:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R2054:Sis UTSW 3 72,820,570 (GRCm39) missense probably benign 0.01
R2233:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2235:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2276:Sis UTSW 3 72,821,934 (GRCm39) nonsense probably null
R2435:Sis UTSW 3 72,819,237 (GRCm39) missense probably benign 0.01
R2885:Sis UTSW 3 72,816,506 (GRCm39) missense probably benign 0.01
R2966:Sis UTSW 3 72,796,343 (GRCm39) missense probably benign 0.30
R3708:Sis UTSW 3 72,850,856 (GRCm39) missense probably benign 0.02
R3790:Sis UTSW 3 72,828,747 (GRCm39) missense probably damaging 1.00
R3807:Sis UTSW 3 72,832,929 (GRCm39) missense probably benign 0.01
R3858:Sis UTSW 3 72,835,985 (GRCm39) missense probably damaging 0.99
R3974:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R3975:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R4037:Sis UTSW 3 72,835,935 (GRCm39) missense probably benign
R4080:Sis UTSW 3 72,828,517 (GRCm39) missense probably damaging 1.00
R4204:Sis UTSW 3 72,868,415 (GRCm39) missense probably benign
R4394:Sis UTSW 3 72,863,482 (GRCm39) missense probably damaging 1.00
R4470:Sis UTSW 3 72,835,492 (GRCm39) splice site probably null
R4573:Sis UTSW 3 72,835,570 (GRCm39) missense possibly damaging 0.94
R4868:Sis UTSW 3 72,850,881 (GRCm39) missense probably benign 0.09
R5023:Sis UTSW 3 72,841,455 (GRCm39) missense probably benign 0.05
R5264:Sis UTSW 3 72,857,089 (GRCm39) missense probably damaging 0.98
R5414:Sis UTSW 3 72,859,826 (GRCm39) missense probably benign
R5462:Sis UTSW 3 72,857,171 (GRCm39) missense probably damaging 0.96
R5584:Sis UTSW 3 72,817,748 (GRCm39) missense probably damaging 1.00
R5587:Sis UTSW 3 72,821,909 (GRCm39) missense possibly damaging 0.94
R5725:Sis UTSW 3 72,872,931 (GRCm39) missense probably damaging 1.00
R5769:Sis UTSW 3 72,835,568 (GRCm39) missense probably damaging 0.98
R5790:Sis UTSW 3 72,835,507 (GRCm39) missense probably benign
R5864:Sis UTSW 3 72,857,151 (GRCm39) missense probably damaging 1.00
R5902:Sis UTSW 3 72,867,589 (GRCm39) critical splice donor site probably null
R5925:Sis UTSW 3 72,828,713 (GRCm39) splice site probably null
R6018:Sis UTSW 3 72,820,525 (GRCm39) missense possibly damaging 0.95
R6029:Sis UTSW 3 72,835,641 (GRCm39) missense probably benign 0.30
R6124:Sis UTSW 3 72,860,544 (GRCm39) missense possibly damaging 0.69
R6171:Sis UTSW 3 72,868,360 (GRCm39) missense possibly damaging 0.75
R6182:Sis UTSW 3 72,811,626 (GRCm39) missense probably benign 0.05
R6295:Sis UTSW 3 72,874,103 (GRCm39) missense probably damaging 0.99
R6416:Sis UTSW 3 72,819,187 (GRCm39) missense probably damaging 1.00
R6431:Sis UTSW 3 72,865,507 (GRCm39) missense probably benign 0.00
R6472:Sis UTSW 3 72,846,067 (GRCm39) nonsense probably null
R6517:Sis UTSW 3 72,814,475 (GRCm39) missense probably damaging 1.00
R6701:Sis UTSW 3 72,856,860 (GRCm39) missense probably damaging 1.00
R6796:Sis UTSW 3 72,872,951 (GRCm39) missense probably benign 0.06
R6853:Sis UTSW 3 72,798,759 (GRCm39) missense possibly damaging 0.93
R6906:Sis UTSW 3 72,826,818 (GRCm39) missense probably damaging 1.00
R7058:Sis UTSW 3 72,810,940 (GRCm39) missense probably damaging 0.98
R7357:Sis UTSW 3 72,832,404 (GRCm39) missense probably damaging 1.00
R7381:Sis UTSW 3 72,820,625 (GRCm39) splice site probably null
R7439:Sis UTSW 3 72,816,374 (GRCm39) missense possibly damaging 0.81
R7742:Sis UTSW 3 72,832,431 (GRCm39) missense probably benign 0.19
R7813:Sis UTSW 3 72,832,801 (GRCm39) missense probably benign 0.01
R7883:Sis UTSW 3 72,828,329 (GRCm39) missense possibly damaging 0.78
R7899:Sis UTSW 3 72,844,584 (GRCm39) missense probably damaging 1.00
R7915:Sis UTSW 3 72,828,471 (GRCm39) missense probably damaging 0.99
R7985:Sis UTSW 3 72,844,294 (GRCm39) splice site probably null
R8020:Sis UTSW 3 72,816,298 (GRCm39) critical splice donor site probably null
R8023:Sis UTSW 3 72,859,813 (GRCm39) missense probably damaging 0.97
R8029:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R8053:Sis UTSW 3 72,856,901 (GRCm39) nonsense probably null
R8062:Sis UTSW 3 72,828,321 (GRCm39) nonsense probably null
R8074:Sis UTSW 3 72,824,531 (GRCm39) missense probably damaging 1.00
R8085:Sis UTSW 3 72,814,462 (GRCm39) missense probably damaging 1.00
R8137:Sis UTSW 3 72,796,378 (GRCm39) missense probably benign 0.22
R8349:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8354:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8366:Sis UTSW 3 72,865,566 (GRCm39) missense probably damaging 1.00
R8449:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8454:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8474:Sis UTSW 3 72,836,730 (GRCm39) missense probably damaging 1.00
R8515:Sis UTSW 3 72,836,742 (GRCm39) missense probably benign 0.00
R8680:Sis UTSW 3 72,867,628 (GRCm39) missense probably damaging 1.00
R8703:Sis UTSW 3 72,867,657 (GRCm39) missense probably damaging 1.00
R9098:Sis UTSW 3 72,844,578 (GRCm39) missense possibly damaging 0.66
R9466:Sis UTSW 3 72,872,910 (GRCm39) critical splice donor site probably null
R9574:Sis UTSW 3 72,828,490 (GRCm39) missense probably benign 0.05
R9630:Sis UTSW 3 72,828,722 (GRCm39) missense probably benign 0.11
R9680:Sis UTSW 3 72,863,621 (GRCm39) missense probably benign 0.12
R9709:Sis UTSW 3 72,799,074 (GRCm39) missense possibly damaging 0.47
R9731:Sis UTSW 3 72,835,543 (GRCm39) missense probably benign 0.01
X0009:Sis UTSW 3 72,796,355 (GRCm39) missense probably damaging 0.99
X0024:Sis UTSW 3 72,836,003 (GRCm39) missense probably benign
X0060:Sis UTSW 3 72,828,239 (GRCm39) intron probably benign
Z1176:Sis UTSW 3 72,850,890 (GRCm39) missense probably benign 0.25
Z1176:Sis UTSW 3 72,811,606 (GRCm39) missense probably benign 0.05
Z1177:Sis UTSW 3 72,850,902 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,817,807 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,816,505 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTAGTCCTGGCAATGACCAC -3'
(R):5'- CTCCCGATTCAGTATATAAAGCAC -3'

Sequencing Primer
(F):5'- CTGGCAATGACCACGAGGAATC -3'
(R):5'- TCATGTTAGATCACAGCTATG -3'
Posted On 2016-10-05