Mutagenetix > Incidental Mutations

Incidental Mutation 'R5523:Baiap2l1'

431662

Institutional Source

Beutler Lab

Gene Symbol

Baiap2l1

Ensembl Gene

ENSMUSG00000038859

Gene Name

BAI1-associated protein 2-like 1

Synonyms

IRTKS, 1300006M19Rik

MMRRC Submission

043265-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5523 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

144264526-144358112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 144275958 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 416 (P416A)

Ref Sequence

ENSEMBL: ENSMUSP00000053129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]

PDB Structure

Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055190
AA Change: P416A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: P416A

Domain	Start	End	E-Value	Type
Pfam:IMD	16	236	4.4e-65	PFAM
SH3	343	402	1.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155491

SMART Domains

Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

Domain	Start	End	E-Value	Type
Pfam:DUF2367	27	90	1.1e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156467

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198873

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	A	3: 153,938,636	T70M	probably benign	Het
Adamtsl3	G	A	7: 82,574,442	A218T	possibly damaging	Het
Ahnak2	T	C	12: 112,775,208	D810G	probably damaging	Het
Ak7	T	A	12: 105,741,082	L315*	probably null	Het
Apoa5	T	C	9: 46,270,589	F321S	possibly damaging	Het
Bco1	A	G	8: 117,108,693	I128V	possibly damaging	Het
Bpifb2	T	C	2: 153,875,985		probably benign	Het
Cdt1	G	A	8: 122,568,093	R13H	possibly damaging	Het
Cenpj	A	G	14: 56,552,423	V723A	probably benign	Het
Chl1	T	A	6: 103,708,714	W849R	probably damaging	Het
Cpne9	A	G	6: 113,290,231	D169G	probably damaging	Het
Cyp2d22	A	G	15: 82,372,571	V334A	probably damaging	Het
Cyp4f39	C	A	17: 32,470,833	N84K	probably benign	Het
Cyp4f40	T	A	17: 32,669,822	F192I	probably damaging	Het
Disp3	T	C	4: 148,258,097	D632G	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Echs1	G	T	7: 140,112,513	T107K	probably benign	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Ergic1	G	A	17: 26,624,606	V17I	probably damaging	Het
Fank1	G	T	7: 133,876,840	C210F	probably damaging	Het
Fbxo15	T	G	18: 84,960,069	M136R	probably damaging	Het
Ggcx	C	A	6: 72,424,034	P240H	probably damaging	Het
Gpr179	T	C	11: 97,336,782	R1516G	probably benign	Het
Gprin3	G	A	6: 59,353,946	Q459*	probably null	Het
Hadha	C	A	5: 30,145,254	V99F	possibly damaging	Het
Hirip3	A	G	7: 126,863,862	D330G	possibly damaging	Het
Irx2	T	C	13: 72,631,595	W333R	probably damaging	Het
Kansl1l	T	C	1: 66,802,112	T10A	probably benign	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Klc3	A	T	7: 19,397,007	I215N	probably damaging	Het
Kmt2c	A	G	5: 25,299,339	V3657A	probably benign	Het
Lin28b	A	T	10: 45,469,068	L54*	probably null	Het
Mgll	T	C	6: 88,725,761	V14A	probably benign	Het
Mrc2	A	G	11: 105,343,582	N976S	probably benign	Het
Myh8	C	A	11: 67,305,962	A1807E	possibly damaging	Het
Nalcn	G	A	14: 123,409,743	P573S	probably damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Neb	T	C	2: 52,278,815	S1903G	probably benign	Het
Nfe2	T	A	15: 103,249,129	D145V	probably damaging	Het
Olfr243	T	A	7: 103,717,480	Y295*	probably null	Het
Padi1	A	T	4: 140,814,853	V586D	probably damaging	Het
Pcdh12	T	C	18: 38,283,139	D311G	probably damaging	Het
Pcdha11	A	T	18: 37,012,386	H510L	probably damaging	Het
Plcb1	C	A	2: 135,260,566	P221H	probably benign	Het
Plekhg2	A	T	7: 28,370,431	V58E	probably damaging	Het
Pparg	A	C	6: 115,490,071	Q435P	probably damaging	Het
Ppp1r36	A	G	12: 76,438,118	T282A	possibly damaging	Het
Prcd	T	C	11: 116,668,284		probably benign	Het
Pygo1	A	T	9: 72,944,984	H151L	possibly damaging	Het
Rnmt	A	G	18: 68,313,702	Y266C	probably benign	Het
Rxrb	T	C	17: 34,036,437	V246A	probably damaging	Het
Sart1	A	G	19: 5,383,676	S378P	probably damaging	Het
Sema4d	T	C	13: 51,711,354	N318S	possibly damaging	Het
Sis	C	T	3: 72,891,421	V1765I	probably benign	Het
Slc17a6	A	T	7: 51,626,850	K116*	probably null	Het
Smc6	T	A	12: 11,291,539	H519Q	probably benign	Het
Sowahc	T	A	10: 59,222,963	M307K	probably benign	Het
Sptbn1	A	G	11: 30,137,560	Y960H	probably damaging	Het
Tmem270	A	C	5: 134,902,782	V102G	probably benign	Het
Tmprss11d	A	G	5: 86,338,870	F54L	probably benign	Het
Top1	T	A	2: 160,702,775	Y270*	probably null	Het
Trpm2	A	G	10: 77,935,961	F615L	probably benign	Het
Ttf2	A	G	3: 100,959,242	S525P	probably damaging	Het
Ttn	A	T	2: 76,946,897	M1387K	possibly damaging	Het
Upk3bl	A	T	5: 136,060,100	R156W	probably damaging	Het
Usp34	G	T	11: 23,349,198	R290L	probably benign	Het
Vwf	T	C	6: 125,643,042	V1561A		Het
Zan	A	G	5: 137,421,893	I2834T	unknown	Het
Zfp105	A	G	9: 122,926,389	Y90C	probably benign	Het
Zfp804a	T	C	2: 82,258,995	V1056A	probably damaging	Het
Zfp956	A	T	6: 47,953,521		probably benign	Het

Other mutations in Baiap2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Baiap2l1	APN	5	144285546	nonsense	probably null
IGL00789:Baiap2l1	APN	5	144286069	splice site	probably null
IGL00922:Baiap2l1	APN	5	144318967	missense	probably damaging	1.00
IGL01446:Baiap2l1	APN	5	144275913	missense	probably benign	0.10
IGL01603:Baiap2l1	APN	5	144280815	intron	probably benign
IGL02748:Baiap2l1	APN	5	144266605	intron	probably benign
IGL03348:Baiap2l1	APN	5	144278531	missense	probably benign	0.08
PIT4382001:Baiap2l1	UTSW	5	144278670	missense	possibly damaging	0.71
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0110:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0197:Baiap2l1	UTSW	5	144266010	missense	probably damaging	0.96
R0469:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0744:Baiap2l1	UTSW	5	144266641	missense	probably benign	0.21
R0755:Baiap2l1	UTSW	5	144284557	missense	probably damaging	0.97
R0765:Baiap2l1	UTSW	5	144277703	missense	probably damaging	0.99
R1051:Baiap2l1	UTSW	5	144286133	missense	probably damaging	1.00
R1809:Baiap2l1	UTSW	5	144324555	critical splice donor site	probably null
R3889:Baiap2l1	UTSW	5	144278535	missense	possibly damaging	0.67
R4451:Baiap2l1	UTSW	5	144278552	missense	probably damaging	1.00
R5093:Baiap2l1	UTSW	5	144278553	missense	probably damaging	1.00
R5471:Baiap2l1	UTSW	5	144282141	missense	probably benign	0.01
R5524:Baiap2l1	UTSW	5	144280949	missense	probably benign	0.01
R5586:Baiap2l1	UTSW	5	144282139	missense	probably damaging	0.99
R5603:Baiap2l1	UTSW	5	144265977	missense	probably damaging	1.00
R5735:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6353:Baiap2l1	UTSW	5	144282088	missense	possibly damaging	0.80
R6572:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6619:Baiap2l1	UTSW	5	144286106	missense	probably benign	0.22
R6981:Baiap2l1	UTSW	5	144285579	missense	possibly damaging	0.94
R7218:Baiap2l1	UTSW	5	144275877	missense	probably benign	0.01
R7352:Baiap2l1	UTSW	5	144324626	missense	probably benign	0.03
R7662:Baiap2l1	UTSW	5	144357890	intron	probably benign
R7797:Baiap2l1	UTSW	5	144318950	missense	probably damaging	1.00
X0022:Baiap2l1	UTSW	5	144278652	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCAACACTCACGGGAGAG -3'
(R):5'- GTGTGTAGCGCAGTACTGTCAC -3'

Sequencing Primer
(F):5'- CTCACGGGAGAGGTGGATGTG -3'
(R):5'- GTATGTCTGTGAACCACATGCAC -3'

Posted On

2016-10-05