Mutagenetix > Incidental Mutation

Incidental Mutation 'R5523:Kcnd2'

431663

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

043265-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R5523 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21723212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 467 (I467T)

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably benign
Transcript: ENSMUST00000081542
AA Change: I467T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: I467T

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	A	3: 153,938,636	T70M	probably benign	Het
Adamtsl3	G	A	7: 82,574,442	A218T	possibly damaging	Het
Ahnak2	T	C	12: 112,775,208	D810G	probably damaging	Het
Ak7	T	A	12: 105,741,082	L315*	probably null	Het
Apoa5	T	C	9: 46,270,589	F321S	possibly damaging	Het
Baiap2l1	G	C	5: 144,275,958	P416A	probably damaging	Het
Bco1	A	G	8: 117,108,693	I128V	possibly damaging	Het
Bpifb2	T	C	2: 153,875,985		probably benign	Het
Cdt1	G	A	8: 122,568,093	R13H	possibly damaging	Het
Cenpj	A	G	14: 56,552,423	V723A	probably benign	Het
Chl1	T	A	6: 103,708,714	W849R	probably damaging	Het
Cpne9	A	G	6: 113,290,231	D169G	probably damaging	Het
Cyp2d22	A	G	15: 82,372,571	V334A	probably damaging	Het
Cyp4f39	C	A	17: 32,470,833	N84K	probably benign	Het
Cyp4f40	T	A	17: 32,669,822	F192I	probably damaging	Het
Disp3	T	C	4: 148,258,097	D632G	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Echs1	G	T	7: 140,112,513	T107K	probably benign	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Ergic1	G	A	17: 26,624,606	V17I	probably damaging	Het
Fank1	G	T	7: 133,876,840	C210F	probably damaging	Het
Fbxo15	T	G	18: 84,960,069	M136R	probably damaging	Het
Ggcx	C	A	6: 72,424,034	P240H	probably damaging	Het
Gpr179	T	C	11: 97,336,782	R1516G	probably benign	Het
Gprin3	G	A	6: 59,353,946	Q459*	probably null	Het
Hadha	C	A	5: 30,145,254	V99F	possibly damaging	Het
Hirip3	A	G	7: 126,863,862	D330G	possibly damaging	Het
Irx2	T	C	13: 72,631,595	W333R	probably damaging	Het
Kansl1l	T	C	1: 66,802,112	T10A	probably benign	Het
Klc3	A	T	7: 19,397,007	I215N	probably damaging	Het
Kmt2c	A	G	5: 25,299,339	V3657A	probably benign	Het
Lin28b	A	T	10: 45,469,068	L54*	probably null	Het
Mgll	T	C	6: 88,725,761	V14A	probably benign	Het
Mrc2	A	G	11: 105,343,582	N976S	probably benign	Het
Myh8	C	A	11: 67,305,962	A1807E	possibly damaging	Het
Nalcn	G	A	14: 123,409,743	P573S	probably damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Neb	T	C	2: 52,278,815	S1903G	probably benign	Het
Nfe2	T	A	15: 103,249,129	D145V	probably damaging	Het
Olfr243	T	A	7: 103,717,480	Y295*	probably null	Het
Padi1	A	T	4: 140,814,853	V586D	probably damaging	Het
Pcdh12	T	C	18: 38,283,139	D311G	probably damaging	Het
Pcdha11	A	T	18: 37,012,386	H510L	probably damaging	Het
Plcb1	C	A	2: 135,260,566	P221H	probably benign	Het
Plekhg2	A	T	7: 28,370,431	V58E	probably damaging	Het
Pparg	A	C	6: 115,490,071	Q435P	probably damaging	Het
Ppp1r36	A	G	12: 76,438,118	T282A	possibly damaging	Het
Prcd	T	C	11: 116,668,284		probably benign	Het
Pygo1	A	T	9: 72,944,984	H151L	possibly damaging	Het
Rnmt	A	G	18: 68,313,702	Y266C	probably benign	Het
Rxrb	T	C	17: 34,036,437	V246A	probably damaging	Het
Sart1	A	G	19: 5,383,676	S378P	probably damaging	Het
Sema4d	T	C	13: 51,711,354	N318S	possibly damaging	Het
Sis	C	T	3: 72,891,421	V1765I	probably benign	Het
Slc17a6	A	T	7: 51,626,850	K116*	probably null	Het
Smc6	T	A	12: 11,291,539	H519Q	probably benign	Het
Sowahc	T	A	10: 59,222,963	M307K	probably benign	Het
Sptbn1	A	G	11: 30,137,560	Y960H	probably damaging	Het
Tmem270	A	C	5: 134,902,782	V102G	probably benign	Het
Tmprss11d	A	G	5: 86,338,870	F54L	probably benign	Het
Top1	T	A	2: 160,702,775	Y270*	probably null	Het
Trpm2	A	G	10: 77,935,961	F615L	probably benign	Het
Ttf2	A	G	3: 100,959,242	S525P	probably damaging	Het
Ttn	A	T	2: 76,946,897	M1387K	possibly damaging	Het
Upk3bl	A	T	5: 136,060,100	R156W	probably damaging	Het
Usp34	G	T	11: 23,349,198	R290L	probably benign	Het
Vwf	T	C	6: 125,643,042	V1561A		Het
Zan	A	G	5: 137,421,893	I2834T	unknown	Het
Zfp105	A	G	9: 122,926,389	Y90C	probably benign	Het
Zfp804a	T	C	2: 82,258,995	V1056A	probably damaging	Het
Zfp956	A	T	6: 47,953,521		probably benign	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21726239	splice site	probably benign
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGAGGTGTCAGCTTAAAAGAC -3'
(R):5'- GGGATGCAGAGGATCAATTTCTG -3'

Sequencing Primer
(F):5'- TGGAAATATGCCCGCTGATC -3'
(R):5'- CAGAGGATCAATTTCTGCTTGG -3'

Posted On

2016-10-05