Incidental Mutation 'R5523:Chl1'
ID431668
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Namecell adhesion molecule L1-like
SynonymsA530023M13Rik, LICAM2, close homolog of L1, CALL
MMRRC Submission 043265-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R5523 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location103510586-103750211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103708714 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 849 (W849R)
Ref Sequence ENSEMBL: ENSMUSP00000144758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
Predicted Effect probably damaging
Transcript: ENSMUST00000066905
AA Change: W849R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: W849R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203830
AA Change: W849R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: W849R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203912
AA Change: W865R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: W865R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205098
AA Change: W122R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077
AA Change: W122R

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,938,636 T70M probably benign Het
Adamtsl3 G A 7: 82,574,442 A218T possibly damaging Het
Ahnak2 T C 12: 112,775,208 D810G probably damaging Het
Ak7 T A 12: 105,741,082 L315* probably null Het
Apoa5 T C 9: 46,270,589 F321S possibly damaging Het
Baiap2l1 G C 5: 144,275,958 P416A probably damaging Het
Bco1 A G 8: 117,108,693 I128V possibly damaging Het
Bpifb2 T C 2: 153,875,985 probably benign Het
Cdt1 G A 8: 122,568,093 R13H possibly damaging Het
Cenpj A G 14: 56,552,423 V723A probably benign Het
Cpne9 A G 6: 113,290,231 D169G probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp4f39 C A 17: 32,470,833 N84K probably benign Het
Cyp4f40 T A 17: 32,669,822 F192I probably damaging Het
Disp3 T C 4: 148,258,097 D632G probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Echs1 G T 7: 140,112,513 T107K probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Ergic1 G A 17: 26,624,606 V17I probably damaging Het
Fank1 G T 7: 133,876,840 C210F probably damaging Het
Fbxo15 T G 18: 84,960,069 M136R probably damaging Het
Ggcx C A 6: 72,424,034 P240H probably damaging Het
Gpr179 T C 11: 97,336,782 R1516G probably benign Het
Gprin3 G A 6: 59,353,946 Q459* probably null Het
Hadha C A 5: 30,145,254 V99F possibly damaging Het
Hirip3 A G 7: 126,863,862 D330G possibly damaging Het
Irx2 T C 13: 72,631,595 W333R probably damaging Het
Kansl1l T C 1: 66,802,112 T10A probably benign Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Klc3 A T 7: 19,397,007 I215N probably damaging Het
Kmt2c A G 5: 25,299,339 V3657A probably benign Het
Lin28b A T 10: 45,469,068 L54* probably null Het
Mgll T C 6: 88,725,761 V14A probably benign Het
Mrc2 A G 11: 105,343,582 N976S probably benign Het
Myh8 C A 11: 67,305,962 A1807E possibly damaging Het
Nalcn G A 14: 123,409,743 P573S probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Neb T C 2: 52,278,815 S1903G probably benign Het
Nfe2 T A 15: 103,249,129 D145V probably damaging Het
Olfr243 T A 7: 103,717,480 Y295* probably null Het
Padi1 A T 4: 140,814,853 V586D probably damaging Het
Pcdh12 T C 18: 38,283,139 D311G probably damaging Het
Pcdha11 A T 18: 37,012,386 H510L probably damaging Het
Plcb1 C A 2: 135,260,566 P221H probably benign Het
Plekhg2 A T 7: 28,370,431 V58E probably damaging Het
Pparg A C 6: 115,490,071 Q435P probably damaging Het
Ppp1r36 A G 12: 76,438,118 T282A possibly damaging Het
Prcd T C 11: 116,668,284 probably benign Het
Pygo1 A T 9: 72,944,984 H151L possibly damaging Het
Rnmt A G 18: 68,313,702 Y266C probably benign Het
Rxrb T C 17: 34,036,437 V246A probably damaging Het
Sart1 A G 19: 5,383,676 S378P probably damaging Het
Sema4d T C 13: 51,711,354 N318S possibly damaging Het
Sis C T 3: 72,891,421 V1765I probably benign Het
Slc17a6 A T 7: 51,626,850 K116* probably null Het
Smc6 T A 12: 11,291,539 H519Q probably benign Het
Sowahc T A 10: 59,222,963 M307K probably benign Het
Sptbn1 A G 11: 30,137,560 Y960H probably damaging Het
Tmem270 A C 5: 134,902,782 V102G probably benign Het
Tmprss11d A G 5: 86,338,870 F54L probably benign Het
Top1 T A 2: 160,702,775 Y270* probably null Het
Trpm2 A G 10: 77,935,961 F615L probably benign Het
Ttf2 A G 3: 100,959,242 S525P probably damaging Het
Ttn A T 2: 76,946,897 M1387K possibly damaging Het
Upk3bl A T 5: 136,060,100 R156W probably damaging Het
Usp34 G T 11: 23,349,198 R290L probably benign Het
Vwf T C 6: 125,643,042 V1561A Het
Zan A G 5: 137,421,893 I2834T unknown Het
Zfp105 A G 9: 122,926,389 Y90C probably benign Het
Zfp804a T C 2: 82,258,995 V1056A probably damaging Het
Zfp956 A T 6: 47,953,521 probably benign Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103693061 missense probably benign 0.08
IGL00786:Chl1 APN 6 103675145 missense probably damaging 1.00
IGL00959:Chl1 APN 6 103709250 splice site probably null
IGL01109:Chl1 APN 6 103715393 missense probably damaging 1.00
IGL01354:Chl1 APN 6 103665853 missense probably benign 0.01
IGL01367:Chl1 APN 6 103729225 missense probably benign 0.42
IGL01371:Chl1 APN 6 103715364 missense probably damaging 1.00
IGL01599:Chl1 APN 6 103708484 missense probably benign 0.34
IGL01724:Chl1 APN 6 103649573 missense probably damaging 1.00
IGL02001:Chl1 APN 6 103642056 missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103698224 missense probably benign 0.39
IGL02122:Chl1 APN 6 103675137 missense probably benign 0.39
IGL02340:Chl1 APN 6 103698125 missense probably damaging 1.00
IGL02420:Chl1 APN 6 103715369 missense probably damaging 1.00
IGL02421:Chl1 APN 6 103717580 missense probably damaging 1.00
IGL02429:Chl1 APN 6 103664809 unclassified probably benign
IGL02825:Chl1 APN 6 103668803 missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103641988 missense probably damaging 1.00
IGL03169:Chl1 APN 6 103665967 missense probably damaging 1.00
IGL03185:Chl1 APN 6 103665863 missense probably damaging 1.00
IGL03189:Chl1 APN 6 103683207 missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103675097 missense probably damaging 1.00
IGL03404:Chl1 APN 6 103693091 missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103691667 missense probably benign 0.01
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0062:Chl1 UTSW 6 103749652 missense unknown
R0314:Chl1 UTSW 6 103647301 missense probably damaging 1.00
R0322:Chl1 UTSW 6 103701883 splice site probably benign
R0685:Chl1 UTSW 6 103708542 splice site probably null
R0702:Chl1 UTSW 6 103706622 missense probably damaging 1.00
R1056:Chl1 UTSW 6 103675077 missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103693179 missense probably benign 0.05
R1483:Chl1 UTSW 6 103647287 missense probably damaging 1.00
R1571:Chl1 UTSW 6 103708484 missense probably benign 0.34
R1620:Chl1 UTSW 6 103690242 missense probably benign 0.00
R1645:Chl1 UTSW 6 103683180 missense probably benign 0.06
R1773:Chl1 UTSW 6 103647331 critical splice donor site probably null
R1852:Chl1 UTSW 6 103699159 splice site probably null
R1891:Chl1 UTSW 6 103714583 missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2147:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2148:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2163:Chl1 UTSW 6 103711231 missense probably damaging 1.00
R2291:Chl1 UTSW 6 103715393 missense probably damaging 1.00
R2920:Chl1 UTSW 6 103695343 missense probably damaging 1.00
R3611:Chl1 UTSW 6 103698155 missense probably damaging 1.00
R3979:Chl1 UTSW 6 103715284 nonsense probably null
R4987:Chl1 UTSW 6 103674977 missense probably damaging 1.00
R5266:Chl1 UTSW 6 103700543 missense probably damaging 1.00
R5478:Chl1 UTSW 6 103683221 missense probably damaging 1.00
R5887:Chl1 UTSW 6 103717604 missense probably benign 0.00
R5986:Chl1 UTSW 6 103709191 missense probably benign 0.45
R6101:Chl1 UTSW 6 103693032 missense probably damaging 0.96
R6179:Chl1 UTSW 6 103683243 missense probably benign 0.38
R6366:Chl1 UTSW 6 103729236 missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103690259 missense probably damaging 1.00
R6824:Chl1 UTSW 6 103714549 missense probably damaging 1.00
R6913:Chl1 UTSW 6 103665948 nonsense probably null
R7097:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7122:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7198:Chl1 UTSW 6 103706556 missense probably damaging 1.00
R7203:Chl1 UTSW 6 103691674 missense probably benign 0.13
R7527:Chl1 UTSW 6 103711201 missense probably damaging 1.00
R7625:Chl1 UTSW 6 103729125 missense probably damaging 1.00
R7667:Chl1 UTSW 6 103695495 missense possibly damaging 0.82
R7683:Chl1 UTSW 6 103691652 missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103711102 missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103691674 missense probably benign 0.01
R7863:Chl1 UTSW 6 103706514 missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103690263 missense probably benign 0.22
R7998:Chl1 UTSW 6 103729289 missense probably benign 0.01
R8044:Chl1 UTSW 6 103706632 missense probably damaging 0.96
R8059:Chl1 UTSW 6 103674987 missense probably damaging 0.97
Z1177:Chl1 UTSW 6 103693096 nonsense probably null
Z1177:Chl1 UTSW 6 103697949 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGAAACAGTACACGGACTTC -3'
(R):5'- TGTCTGAAATATATAAGGCTCGCTC -3'

Sequencing Primer
(F):5'- TACACGGACTTCTAAGAGGGTAC -3'
(R):5'- AATATATAAGGCTCGCTCTCTGGACC -3'
Posted On2016-10-05