Incidental Mutation 'R5523:Pparg'
ID431670
Institutional Source Beutler Lab
Gene Symbol Pparg
Ensembl Gene ENSMUSG00000000440
Gene Nameperoxisome proliferator activated receptor gamma
SynonymsPpar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
MMRRC Submission 043265-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5523 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115360951-115490399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115490071 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 435 (Q435P)
Ref Sequence ENSEMBL: ENSMUSP00000145525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732]
Predicted Effect probably damaging
Transcript: ENSMUST00000000450
AA Change: Q465P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: Q465P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171644
AA Change: Q435P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: Q435P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203732
AA Change: Q435P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: Q435P

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,938,636 T70M probably benign Het
Adamtsl3 G A 7: 82,574,442 A218T possibly damaging Het
Ahnak2 T C 12: 112,775,208 D810G probably damaging Het
Ak7 T A 12: 105,741,082 L315* probably null Het
Apoa5 T C 9: 46,270,589 F321S possibly damaging Het
Baiap2l1 G C 5: 144,275,958 P416A probably damaging Het
Bco1 A G 8: 117,108,693 I128V possibly damaging Het
Bpifb2 T C 2: 153,875,985 probably benign Het
Cdt1 G A 8: 122,568,093 R13H possibly damaging Het
Cenpj A G 14: 56,552,423 V723A probably benign Het
Chl1 T A 6: 103,708,714 W849R probably damaging Het
Cpne9 A G 6: 113,290,231 D169G probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp4f39 C A 17: 32,470,833 N84K probably benign Het
Cyp4f40 T A 17: 32,669,822 F192I probably damaging Het
Disp3 T C 4: 148,258,097 D632G probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Echs1 G T 7: 140,112,513 T107K probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Ergic1 G A 17: 26,624,606 V17I probably damaging Het
Fank1 G T 7: 133,876,840 C210F probably damaging Het
Fbxo15 T G 18: 84,960,069 M136R probably damaging Het
Ggcx C A 6: 72,424,034 P240H probably damaging Het
Gpr179 T C 11: 97,336,782 R1516G probably benign Het
Gprin3 G A 6: 59,353,946 Q459* probably null Het
Hadha C A 5: 30,145,254 V99F possibly damaging Het
Hirip3 A G 7: 126,863,862 D330G possibly damaging Het
Irx2 T C 13: 72,631,595 W333R probably damaging Het
Kansl1l T C 1: 66,802,112 T10A probably benign Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Klc3 A T 7: 19,397,007 I215N probably damaging Het
Kmt2c A G 5: 25,299,339 V3657A probably benign Het
Lin28b A T 10: 45,469,068 L54* probably null Het
Mgll T C 6: 88,725,761 V14A probably benign Het
Mrc2 A G 11: 105,343,582 N976S probably benign Het
Myh8 C A 11: 67,305,962 A1807E possibly damaging Het
Nalcn G A 14: 123,409,743 P573S probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Neb T C 2: 52,278,815 S1903G probably benign Het
Nfe2 T A 15: 103,249,129 D145V probably damaging Het
Olfr243 T A 7: 103,717,480 Y295* probably null Het
Padi1 A T 4: 140,814,853 V586D probably damaging Het
Pcdh12 T C 18: 38,283,139 D311G probably damaging Het
Pcdha11 A T 18: 37,012,386 H510L probably damaging Het
Plcb1 C A 2: 135,260,566 P221H probably benign Het
Plekhg2 A T 7: 28,370,431 V58E probably damaging Het
Ppp1r36 A G 12: 76,438,118 T282A possibly damaging Het
Prcd T C 11: 116,668,284 probably benign Het
Pygo1 A T 9: 72,944,984 H151L possibly damaging Het
Rnmt A G 18: 68,313,702 Y266C probably benign Het
Rxrb T C 17: 34,036,437 V246A probably damaging Het
Sart1 A G 19: 5,383,676 S378P probably damaging Het
Sema4d T C 13: 51,711,354 N318S possibly damaging Het
Sis C T 3: 72,891,421 V1765I probably benign Het
Slc17a6 A T 7: 51,626,850 K116* probably null Het
Smc6 T A 12: 11,291,539 H519Q probably benign Het
Sowahc T A 10: 59,222,963 M307K probably benign Het
Sptbn1 A G 11: 30,137,560 Y960H probably damaging Het
Tmem270 A C 5: 134,902,782 V102G probably benign Het
Tmprss11d A G 5: 86,338,870 F54L probably benign Het
Top1 T A 2: 160,702,775 Y270* probably null Het
Trpm2 A G 10: 77,935,961 F615L probably benign Het
Ttf2 A G 3: 100,959,242 S525P probably damaging Het
Ttn A T 2: 76,946,897 M1387K possibly damaging Het
Upk3bl A T 5: 136,060,100 R156W probably damaging Het
Usp34 G T 11: 23,349,198 R290L probably benign Het
Vwf T C 6: 125,643,042 V1561A Het
Zan A G 5: 137,421,893 I2834T unknown Het
Zfp105 A G 9: 122,926,389 Y90C probably benign Het
Zfp804a T C 2: 82,258,995 V1056A probably damaging Het
Zfp956 A T 6: 47,953,521 probably benign Het
Other mutations in Pparg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
Energy UTSW 6 115451044 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R2339:Pparg UTSW 6 115451044 missense probably damaging 1.00
R4429:Pparg UTSW 6 115440023 missense probably benign 0.09
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R4946:Pparg UTSW 6 115451028 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
R6994:Pparg UTSW 6 115451050 missense probably benign 0.36
R7177:Pparg UTSW 6 115441620 missense probably benign 0.40
R7755:Pparg UTSW 6 115463106 missense probably damaging 1.00
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGGTCTGACAAAGCCTC -3'
(R):5'- ATCTGTGATGGCAGAATGGG -3'

Sequencing Primer
(F):5'- AGGTCTGACAAAGCCTCTTTTTG -3'
(R):5'- CAGAATGGGAGACATGCATTCATTC -3'
Posted On2016-10-05