Incidental Mutation 'R5523:Vwf'
ID 431671
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
MMRRC Submission 043265-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5523 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125643042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1561 (V1561A)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect not run
Transcript: ENSMUST00000001995
AA Change: V1561A
SMART Domains Protein: ENSMUSP00000001995
Gene: ENSMUSG00000001930
AA Change: V1561A

DomainStartEndE-ValueType
VWD 20 178 3.43e-35 SMART
C8 218 292 1.11e-21 SMART
Pfam:TIL 295 348 2.9e-14 PFAM
VWC 350 410 8.71e-1 SMART
VWD 377 540 2.93e-52 SMART
C8 577 649 3.82e-25 SMART
Pfam:TIL 652 707 5.7e-14 PFAM
EGF_like 787 822 4.37e1 SMART
VWC 829 898 3.29e-3 SMART
VWD 856 1012 5.15e-39 SMART
C8 1053 1127 1.01e-33 SMART
Pfam:TIL 1141 1196 3.6e-9 PFAM
VWA 1275 1458 1.81e-20 SMART
low complexity region 1461 1474 N/A INTRINSIC
VWA 1496 1669 8.43e-39 SMART
VWA 1689 1872 2.83e-31 SMART
VWC 1879 1946 2.99e0 SMART
VWD 1938 2101 5.03e-42 SMART
C8 2132 2200 1.29e-13 SMART
Pfam:TIL 2203 2254 1.2e-7 PFAM
VWC 2257 2325 3.16e-16 SMART
low complexity region 2414 2425 N/A INTRINSIC
VWC 2431 2494 2.61e-17 SMART
VWC 2510 2574 3.37e0 SMART
VWC 2582 2644 2.55e-11 SMART
CT 2727 2812 1.37e-31 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: V1561A

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141521
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,938,636 T70M probably benign Het
Adamtsl3 G A 7: 82,574,442 A218T possibly damaging Het
Ahnak2 T C 12: 112,775,208 D810G probably damaging Het
Ak7 T A 12: 105,741,082 L315* probably null Het
Apoa5 T C 9: 46,270,589 F321S possibly damaging Het
Baiap2l1 G C 5: 144,275,958 P416A probably damaging Het
Bco1 A G 8: 117,108,693 I128V possibly damaging Het
Bpifb2 T C 2: 153,875,985 probably benign Het
Cdt1 G A 8: 122,568,093 R13H possibly damaging Het
Cenpj A G 14: 56,552,423 V723A probably benign Het
Chl1 T A 6: 103,708,714 W849R probably damaging Het
Cpne9 A G 6: 113,290,231 D169G probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp4f39 C A 17: 32,470,833 N84K probably benign Het
Cyp4f40 T A 17: 32,669,822 F192I probably damaging Het
Disp3 T C 4: 148,258,097 D632G probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Echs1 G T 7: 140,112,513 T107K probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Ergic1 G A 17: 26,624,606 V17I probably damaging Het
Fank1 G T 7: 133,876,840 C210F probably damaging Het
Fbxo15 T G 18: 84,960,069 M136R probably damaging Het
Ggcx C A 6: 72,424,034 P240H probably damaging Het
Gpr179 T C 11: 97,336,782 R1516G probably benign Het
Gprin3 G A 6: 59,353,946 Q459* probably null Het
Hadha C A 5: 30,145,254 V99F possibly damaging Het
Hirip3 A G 7: 126,863,862 D330G possibly damaging Het
Irx2 T C 13: 72,631,595 W333R probably damaging Het
Kansl1l T C 1: 66,802,112 T10A probably benign Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Klc3 A T 7: 19,397,007 I215N probably damaging Het
Kmt2c A G 5: 25,299,339 V3657A probably benign Het
Lin28b A T 10: 45,469,068 L54* probably null Het
Mgll T C 6: 88,725,761 V14A probably benign Het
Mrc2 A G 11: 105,343,582 N976S probably benign Het
Myh8 C A 11: 67,305,962 A1807E possibly damaging Het
Nalcn G A 14: 123,409,743 P573S probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Neb T C 2: 52,278,815 S1903G probably benign Het
Nfe2 T A 15: 103,249,129 D145V probably damaging Het
Olfr243 T A 7: 103,717,480 Y295* probably null Het
Padi1 A T 4: 140,814,853 V586D probably damaging Het
Pcdh12 T C 18: 38,283,139 D311G probably damaging Het
Pcdha11 A T 18: 37,012,386 H510L probably damaging Het
Plcb1 C A 2: 135,260,566 P221H probably benign Het
Plekhg2 A T 7: 28,370,431 V58E probably damaging Het
Pparg A C 6: 115,490,071 Q435P probably damaging Het
Ppp1r36 A G 12: 76,438,118 T282A possibly damaging Het
Prcd T C 11: 116,668,284 probably benign Het
Pygo1 A T 9: 72,944,984 H151L possibly damaging Het
Rnmt A G 18: 68,313,702 Y266C probably benign Het
Rxrb T C 17: 34,036,437 V246A probably damaging Het
Sart1 A G 19: 5,383,676 S378P probably damaging Het
Sema4d T C 13: 51,711,354 N318S possibly damaging Het
Sis C T 3: 72,891,421 V1765I probably benign Het
Slc17a6 A T 7: 51,626,850 K116* probably null Het
Smc6 T A 12: 11,291,539 H519Q probably benign Het
Sowahc T A 10: 59,222,963 M307K probably benign Het
Sptbn1 A G 11: 30,137,560 Y960H probably damaging Het
Tmem270 A C 5: 134,902,782 V102G probably benign Het
Tmprss11d A G 5: 86,338,870 F54L probably benign Het
Top1 T A 2: 160,702,775 Y270* probably null Het
Trpm2 A G 10: 77,935,961 F615L probably benign Het
Ttf2 A G 3: 100,959,242 S525P probably damaging Het
Ttn A T 2: 76,946,897 M1387K possibly damaging Het
Upk3bl A T 5: 136,060,100 R156W probably damaging Het
Usp34 G T 11: 23,349,198 R290L probably benign Het
Zan A G 5: 137,421,893 I2834T unknown Het
Zfp105 A G 9: 122,926,389 Y90C probably benign Het
Zfp804a T C 2: 82,258,995 V1056A probably damaging Het
Zfp956 A T 6: 47,953,521 probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9136:Vwf UTSW 6 125599393 splice site probably benign
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
R9508:Vwf UTSW 6 125555508 missense
R9553:Vwf UTSW 6 125600699 missense
R9660:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9706:Vwf UTSW 6 125624573 missense
R9708:Vwf UTSW 6 125657090 missense
R9712:Vwf UTSW 6 125624573 missense
R9714:Vwf UTSW 6 125624573 missense
R9728:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9758:Vwf UTSW 6 125626267 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGGAAGTCCATGGTTCTGGATG -3'
(R):5'- CTCCAGTTCCTGCATGTTGG -3'

Sequencing Primer
(F):5'- TTTGTCCTGGAGGGGTCAGAC -3'
(R):5'- TGGATGTCTCCAGGCAACCTC -3'
Posted On 2016-10-05