Incidental Mutation 'R5523:Adamtsl3'
ID431677
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission 043265-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5523 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82574442 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 218 (A218T)
Ref Sequence ENSEMBL: ENSMUSP00000133337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably benign
Transcript: ENSMUST00000173287
AA Change: A1144T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: A1144T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173828
AA Change: A218T

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: A218T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,938,636 T70M probably benign Het
Ahnak2 T C 12: 112,775,208 D810G probably damaging Het
Ak7 T A 12: 105,741,082 L315* probably null Het
Apoa5 T C 9: 46,270,589 F321S possibly damaging Het
Baiap2l1 G C 5: 144,275,958 P416A probably damaging Het
Bco1 A G 8: 117,108,693 I128V possibly damaging Het
Bpifb2 T C 2: 153,875,985 probably benign Het
Cdt1 G A 8: 122,568,093 R13H possibly damaging Het
Cenpj A G 14: 56,552,423 V723A probably benign Het
Chl1 T A 6: 103,708,714 W849R probably damaging Het
Cpne9 A G 6: 113,290,231 D169G probably damaging Het
Cyp2d22 A G 15: 82,372,571 V334A probably damaging Het
Cyp4f39 C A 17: 32,470,833 N84K probably benign Het
Cyp4f40 T A 17: 32,669,822 F192I probably damaging Het
Disp3 T C 4: 148,258,097 D632G probably benign Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Echs1 G T 7: 140,112,513 T107K probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Ergic1 G A 17: 26,624,606 V17I probably damaging Het
Fank1 G T 7: 133,876,840 C210F probably damaging Het
Fbxo15 T G 18: 84,960,069 M136R probably damaging Het
Ggcx C A 6: 72,424,034 P240H probably damaging Het
Gpr179 T C 11: 97,336,782 R1516G probably benign Het
Gprin3 G A 6: 59,353,946 Q459* probably null Het
Hadha C A 5: 30,145,254 V99F possibly damaging Het
Hirip3 A G 7: 126,863,862 D330G possibly damaging Het
Irx2 T C 13: 72,631,595 W333R probably damaging Het
Kansl1l T C 1: 66,802,112 T10A probably benign Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Klc3 A T 7: 19,397,007 I215N probably damaging Het
Kmt2c A G 5: 25,299,339 V3657A probably benign Het
Lin28b A T 10: 45,469,068 L54* probably null Het
Mgll T C 6: 88,725,761 V14A probably benign Het
Mrc2 A G 11: 105,343,582 N976S probably benign Het
Myh8 C A 11: 67,305,962 A1807E possibly damaging Het
Nalcn G A 14: 123,409,743 P573S probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Neb T C 2: 52,278,815 S1903G probably benign Het
Nfe2 T A 15: 103,249,129 D145V probably damaging Het
Olfr243 T A 7: 103,717,480 Y295* probably null Het
Padi1 A T 4: 140,814,853 V586D probably damaging Het
Pcdh12 T C 18: 38,283,139 D311G probably damaging Het
Pcdha11 A T 18: 37,012,386 H510L probably damaging Het
Plcb1 C A 2: 135,260,566 P221H probably benign Het
Plekhg2 A T 7: 28,370,431 V58E probably damaging Het
Pparg A C 6: 115,490,071 Q435P probably damaging Het
Ppp1r36 A G 12: 76,438,118 T282A possibly damaging Het
Prcd T C 11: 116,668,284 probably benign Het
Pygo1 A T 9: 72,944,984 H151L possibly damaging Het
Rnmt A G 18: 68,313,702 Y266C probably benign Het
Rxrb T C 17: 34,036,437 V246A probably damaging Het
Sart1 A G 19: 5,383,676 S378P probably damaging Het
Sema4d T C 13: 51,711,354 N318S possibly damaging Het
Sis C T 3: 72,891,421 V1765I probably benign Het
Slc17a6 A T 7: 51,626,850 K116* probably null Het
Smc6 T A 12: 11,291,539 H519Q probably benign Het
Sowahc T A 10: 59,222,963 M307K probably benign Het
Sptbn1 A G 11: 30,137,560 Y960H probably damaging Het
Tmem270 A C 5: 134,902,782 V102G probably benign Het
Tmprss11d A G 5: 86,338,870 F54L probably benign Het
Top1 T A 2: 160,702,775 Y270* probably null Het
Trpm2 A G 10: 77,935,961 F615L probably benign Het
Ttf2 A G 3: 100,959,242 S525P probably damaging Het
Ttn A T 2: 76,946,897 M1387K possibly damaging Het
Upk3bl A T 5: 136,060,100 R156W probably damaging Het
Usp34 G T 11: 23,349,198 R290L probably benign Het
Vwf T C 6: 125,643,042 V1561A Het
Zan A G 5: 137,421,893 I2834T unknown Het
Zfp105 A G 9: 122,926,389 Y90C probably benign Het
Zfp804a T C 2: 82,258,995 V1056A probably damaging Het
Zfp956 A T 6: 47,953,521 probably benign Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R7941:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGTTTAAGAACAAGCAGTTTG -3'
(R):5'- CTTGCTGGGAGTAATGAGGC -3'

Sequencing Primer
(F):5'- GCAGTTTGAAGCAGCCATG -3'
(R):5'- GGCTGCAAAGTATATTGATGATCTCC -3'
Posted On2016-10-05