Mutagenetix > Incidental Mutations

Incidental Mutation 'R0469:Rbp3'

43168

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

038669-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.767) question?

Stock #

R0469 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33962419 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1135 (K1135R)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695] [ENSMUST00000166737]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035695
AA Change: K1135R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: K1135R

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166737

SMART Domains

Protein: ENSMUSP00000132436
Gene: ENSMUSG00000044519

Domain	Start	End	E-Value	Type
low complexity region	161	175	N/A	INTRINSIC
low complexity region	244	270	N/A	INTRINSIC
ZnF_C2H2	272	294	2.89e1	SMART
ZnF_C2H2	314	336	5.06e-2	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Acoxl	G	A	2: 127,880,503		probably null	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Arih2	T	A	9: 108,605,092	H490L	possibly damaging	Het
Arpc1b	T	A	5: 145,127,715	W361R	probably damaging	Het
B3gntl1	A	T	11: 121,673,025	V3D	probably benign	Het
Baiap2l1	T	C	5: 144,275,891	Y438C	probably damaging	Het
Bicc1	C	A	10: 71,079,215	R73L	probably benign	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cep76	A	T	18: 67,634,780	N227K	probably benign	Het
Col6a4	A	T	9: 106,080,547	V26D	probably damaging	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Cpsf2	T	C	12: 101,988,786	V272A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dnah12	A	G	14: 26,798,899	R1892G	probably damaging	Het
Efr3b	G	T	12: 3,982,058	D183E	probably benign	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Ggn	C	T	7: 29,171,296	P47S	probably damaging	Het
Gli3	T	G	13: 15,724,785	L919R	probably damaging	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Golgb1	A	G	16: 36,931,635	I3144V	probably benign	Het
Gpr108	T	C	17: 57,235,358	D549G	possibly damaging	Het
Gpr39	C	T	1: 125,677,500	T55M	probably damaging	Het
Grk4	A	G	5: 34,716,213	T208A	probably damaging	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
H2-Eb2	C	T	17: 34,334,244	Q135*	probably null	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Hnrnph3	T	A	10: 63,019,500	D2V	probably damaging	Het
Hnrnph3	T	A	10: 63,018,215	R41S	probably benign	Het
Hs3st2	T	C	7: 121,500,569	S213P	probably damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Kctd21	T	C	7: 97,347,541	F74L	probably damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Lmtk3	T	A	7: 45,794,112	L740M	possibly damaging	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Naca	C	T	10: 128,044,790	A1897V	probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr338	A	T	2: 36,377,462	I229F	probably benign	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pkn1	C	A	8: 83,672,324	C678F	probably damaging	Het
Pla2g4a	T	A	1: 149,840,647	M688L	possibly damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Psen2	T	C	1: 180,238,914	T153A	probably damaging	Het
Rbmx	C	T	X: 57,391,566		probably null	Het
Slco2b1	T	A	7: 99,661,536	M603L	probably benign	Het
Sncaip	A	G	18: 52,868,709	T101A	probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Stk11	T	C	10: 80,126,086	V47A	probably damaging	Het
Sv2b	T	G	7: 75,136,392	M427L	probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	T	C	12: 75,854,149		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Tas2r123	T	C	6: 132,847,332	V64A	probably benign	Het
Tm9sf1	A	T	14: 55,641,429	F169I	possibly damaging	Het
Tmpo	A	C	10: 91,163,096	I276M	probably benign	Het
Tnnc1	A	G	14: 31,211,408	D149G	probably damaging	Het
Tpr	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	1: 150,423,667		probably null	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Trim55	G	T	3: 19,671,092	V258L	possibly damaging	Het
Trpm1	G	A	7: 64,223,758	G587D	probably damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ube2u	A	G	4: 100,486,673	I90V	probably benign	Het
Upb1	T	C	10: 75,415,083		probably null	Het
Vmn2r57	A	T	7: 41,427,792	S317T	possibly damaging	Het
Wdr73	G	A	7: 80,897,950	Q107*	probably null	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2113:Rbp3	UTSW	14	33956057	missense	probably benign	0.00
R2138:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2504:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2697:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7256:Rbp3	UTSW	14	33962583	missense	possibly damaging	0.93
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41
R7845:Rbp3	UTSW	14	33956464	missense	probably benign	0.24
R8176:Rbp3	UTSW	14	33955648	missense	possibly damaging	0.67
R8281:Rbp3	UTSW	14	33956363	missense	probably benign	0.00
R8393:Rbp3	UTSW	14	33956199	missense	possibly damaging	0.93
R8552:Rbp3	UTSW	14	33955664	missense	probably benign	0.01
R8730:Rbp3	UTSW	14	33955838	missense	not run
R8773:Rbp3	UTSW	14	33962535	missense	not run
Z1177:Rbp3	UTSW	14	33954538	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- TGAACGGCTATCCCTGTTTCACG -3'
(R):5'- GACAACTACATTAGGTGTCACGCCC -3'

Sequencing Primer
(F):5'- TGTTTCACGGAGGCAGAC -3'
(R):5'- AGGAACTTCCGTCTTCAGCG -3'

Posted On

2013-05-23