Mutagenetix > Incidental Mutation

Incidental Mutation 'R5523:Irx2'

431706

Institutional Source

Beutler Lab

Gene Symbol

Irx2

Ensembl Gene

ENSMUSG00000001504

Gene Name

Iroquois homeobox 2

Synonyms

IRX6

MMRRC Submission

043265-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.745) question?

Stock #

R5523 (G1)

Quality Score

201

Status

Not validated

Chromosome

Chromosomal Location

72628820-72634198 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72631595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 333 (W333R)

Ref Sequence

ENSEMBL: ENSMUSP00000073976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]

AlphaFold

P81066

Predicted Effect

probably damaging
Transcript: ENSMUST00000074372
AA Change: W333R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: W333R

Domain	Start	End	E-Value	Type
low complexity region	51	64	N/A	INTRINSIC
low complexity region	70	78	N/A	INTRINSIC
HOX	115	180	1.14e-12	SMART
low complexity region	188	196	N/A	INTRINSIC
low complexity region	256	278	N/A	INTRINSIC
low complexity region	293	305	N/A	INTRINSIC
IRO	325	342	2.28e-5	SMART
low complexity region	346	382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163393

Predicted Effect

probably benign
Transcript: ENSMUST00000167067

SMART Domains

Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

Domain	Start	End	E-Value	Type
HOX	21	86	1.14e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169028

Predicted Effect

probably benign
Transcript: ENSMUST00000172353

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177421

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.4%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	G	A	3: 153,938,636	T70M	probably benign	Het
Adamtsl3	G	A	7: 82,574,442	A218T	possibly damaging	Het
Ahnak2	T	C	12: 112,775,208	D810G	probably damaging	Het
Ak7	T	A	12: 105,741,082	L315*	probably null	Het
Apoa5	T	C	9: 46,270,589	F321S	possibly damaging	Het
Baiap2l1	G	C	5: 144,275,958	P416A	probably damaging	Het
Bco1	A	G	8: 117,108,693	I128V	possibly damaging	Het
Bpifb2	T	C	2: 153,875,985		probably benign	Het
Cdt1	G	A	8: 122,568,093	R13H	possibly damaging	Het
Cenpj	A	G	14: 56,552,423	V723A	probably benign	Het
Chl1	T	A	6: 103,708,714	W849R	probably damaging	Het
Cpne9	A	G	6: 113,290,231	D169G	probably damaging	Het
Cyp2d22	A	G	15: 82,372,571	V334A	probably damaging	Het
Cyp4f39	C	A	17: 32,470,833	N84K	probably benign	Het
Cyp4f40	T	A	17: 32,669,822	F192I	probably damaging	Het
Disp3	T	C	4: 148,258,097	D632G	probably benign	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Echs1	G	T	7: 140,112,513	T107K	probably benign	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Ergic1	G	A	17: 26,624,606	V17I	probably damaging	Het
Fank1	G	T	7: 133,876,840	C210F	probably damaging	Het
Fbxo15	T	G	18: 84,960,069	M136R	probably damaging	Het
Ggcx	C	A	6: 72,424,034	P240H	probably damaging	Het
Gpr179	T	C	11: 97,336,782	R1516G	probably benign	Het
Gprin3	G	A	6: 59,353,946	Q459*	probably null	Het
Hadha	C	A	5: 30,145,254	V99F	possibly damaging	Het
Hirip3	A	G	7: 126,863,862	D330G	possibly damaging	Het
Kansl1l	T	C	1: 66,802,112	T10A	probably benign	Het
Kcnd2	T	C	6: 21,723,212	I467T	probably benign	Het
Klc3	A	T	7: 19,397,007	I215N	probably damaging	Het
Kmt2c	A	G	5: 25,299,339	V3657A	probably benign	Het
Lin28b	A	T	10: 45,469,068	L54*	probably null	Het
Mgll	T	C	6: 88,725,761	V14A	probably benign	Het
Mrc2	A	G	11: 105,343,582	N976S	probably benign	Het
Myh8	C	A	11: 67,305,962	A1807E	possibly damaging	Het
Nalcn	G	A	14: 123,409,743	P573S	probably damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Neb	T	C	2: 52,278,815	S1903G	probably benign	Het
Nfe2	T	A	15: 103,249,129	D145V	probably damaging	Het
Olfr243	T	A	7: 103,717,480	Y295*	probably null	Het
Padi1	A	T	4: 140,814,853	V586D	probably damaging	Het
Pcdh12	T	C	18: 38,283,139	D311G	probably damaging	Het
Pcdha11	A	T	18: 37,012,386	H510L	probably damaging	Het
Plcb1	C	A	2: 135,260,566	P221H	probably benign	Het
Plekhg2	A	T	7: 28,370,431	V58E	probably damaging	Het
Pparg	A	C	6: 115,490,071	Q435P	probably damaging	Het
Ppp1r36	A	G	12: 76,438,118	T282A	possibly damaging	Het
Prcd	T	C	11: 116,668,284		probably benign	Het
Pygo1	A	T	9: 72,944,984	H151L	possibly damaging	Het
Rnmt	A	G	18: 68,313,702	Y266C	probably benign	Het
Rxrb	T	C	17: 34,036,437	V246A	probably damaging	Het
Sart1	A	G	19: 5,383,676	S378P	probably damaging	Het
Sema4d	T	C	13: 51,711,354	N318S	possibly damaging	Het
Sis	C	T	3: 72,891,421	V1765I	probably benign	Het
Slc17a6	A	T	7: 51,626,850	K116*	probably null	Het
Smc6	T	A	12: 11,291,539	H519Q	probably benign	Het
Sowahc	T	A	10: 59,222,963	M307K	probably benign	Het
Sptbn1	A	G	11: 30,137,560	Y960H	probably damaging	Het
Tmem270	A	C	5: 134,902,782	V102G	probably benign	Het
Tmprss11d	A	G	5: 86,338,870	F54L	probably benign	Het
Top1	T	A	2: 160,702,775	Y270*	probably null	Het
Trpm2	A	G	10: 77,935,961	F615L	probably benign	Het
Ttf2	A	G	3: 100,959,242	S525P	probably damaging	Het
Ttn	A	T	2: 76,946,897	M1387K	possibly damaging	Het
Upk3bl	A	T	5: 136,060,100	R156W	probably damaging	Het
Usp34	G	T	11: 23,349,198	R290L	probably benign	Het
Vwf	T	C	6: 125,643,042	V1561A		Het
Zan	A	G	5: 137,421,893	I2834T	unknown	Het
Zfp105	A	G	9: 122,926,389	Y90C	probably benign	Het
Zfp804a	T	C	2: 82,258,995	V1056A	probably damaging	Het
Zfp956	A	T	6: 47,953,521		probably benign	Het

Other mutations in Irx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02749:Irx2	APN	13	72631310	missense	probably damaging	1.00
R0647:Irx2	UTSW	13	72630680	missense	probably damaging	1.00
R0783:Irx2	UTSW	13	72632650	critical splice donor site	probably null
R0931:Irx2	UTSW	13	72631556	missense	possibly damaging	0.71
R0932:Irx2	UTSW	13	72631556	missense	possibly damaging	0.71
R1782:Irx2	UTSW	13	72631466	missense	probably benign	0.19
R2844:Irx2	UTSW	13	72631590	missense	probably damaging	1.00
R4656:Irx2	UTSW	13	72631298	missense	probably damaging	1.00
R4963:Irx2	UTSW	13	72632610	missense	possibly damaging	0.71
R5219:Irx2	UTSW	13	72631301	missense	probably damaging	1.00
R6663:Irx2	UTSW	13	72629129	missense	probably damaging	1.00
R7311:Irx2	UTSW	13	72631277	missense	probably damaging	0.98
R7411:Irx2	UTSW	13	72629063	start codon destroyed	probably null	0.99
R7487:Irx2	UTSW	13	72630620	missense	probably damaging	1.00
R7506:Irx2	UTSW	13	72629209	missense	probably damaging	1.00
R7792:Irx2	UTSW	13	72631374	missense	possibly damaging	0.88
R7953:Irx2	UTSW	13	72629224	missense	probably benign	0.02
R9083:Irx2	UTSW	13	72629273	missense	possibly damaging	0.94
Z1177:Irx2	UTSW	13	72629089	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGATGCCTTGTGCGAATCAG -3'
(R):5'- TGTGTAGTTGCCATAGAAAGGG -3'

Sequencing Primer
(F):5'- CTTGTGCGAATCAGGCTCAGAG -3'
(R):5'- TTGCCATAGAAAGGGGACGTG -3'

Posted On

2016-10-05