Incidental Mutation 'R5523:Irx2'
ID 431706
Institutional Source Beutler Lab
Gene Symbol Irx2
Ensembl Gene ENSMUSG00000001504
Gene Name Iroquois homeobox 2
Synonyms IRX6
MMRRC Submission 043265-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.715) question?
Stock # R5523 (G1)
Quality Score 201
Status Not validated
Chromosome 13
Chromosomal Location 72776939-72782317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72779714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 333 (W333R)
Ref Sequence ENSEMBL: ENSMUSP00000073976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074372] [ENSMUST00000167067] [ENSMUST00000172353]
AlphaFold P81066
Predicted Effect probably damaging
Transcript: ENSMUST00000074372
AA Change: W333R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073976
Gene: ENSMUSG00000001504
AA Change: W333R

DomainStartEndE-ValueType
low complexity region 51 64 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
HOX 115 180 1.14e-12 SMART
low complexity region 188 196 N/A INTRINSIC
low complexity region 256 278 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
IRO 325 342 2.28e-5 SMART
low complexity region 346 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163393
Predicted Effect probably benign
Transcript: ENSMUST00000167067
SMART Domains Protein: ENSMUSP00000127963
Gene: ENSMUSG00000001504

DomainStartEndE-ValueType
HOX 21 86 1.14e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169028
Predicted Effect probably benign
Transcript: ENSMUST00000172353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177421
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for disruptions in this gene are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,644,273 (GRCm39) T70M probably benign Het
Adamtsl3 G A 7: 82,223,650 (GRCm39) A218T possibly damaging Het
Ahnak2 T C 12: 112,741,642 (GRCm39) D810G probably damaging Het
Ak7 T A 12: 105,707,341 (GRCm39) L315* probably null Het
Apoa5 T C 9: 46,181,887 (GRCm39) F321S possibly damaging Het
Baiap2l1 G C 5: 144,212,768 (GRCm39) P416A probably damaging Het
Bco1 A G 8: 117,835,432 (GRCm39) I128V possibly damaging Het
Bpifb2 T C 2: 153,717,905 (GRCm39) probably benign Het
Cdt1 G A 8: 123,294,832 (GRCm39) R13H possibly damaging Het
Cenpj A G 14: 56,789,880 (GRCm39) V723A probably benign Het
Chl1 T A 6: 103,685,675 (GRCm39) W849R probably damaging Het
Cpne9 A G 6: 113,267,192 (GRCm39) D169G probably damaging Het
Cyp2d22 A G 15: 82,256,772 (GRCm39) V334A probably damaging Het
Cyp4f39 C A 17: 32,689,807 (GRCm39) N84K probably benign Het
Cyp4f40 T A 17: 32,888,796 (GRCm39) F192I probably damaging Het
Disp3 T C 4: 148,342,554 (GRCm39) D632G probably benign Het
Dnhd1 G A 7: 105,352,416 (GRCm39) R2523Q probably damaging Het
Echs1 G T 7: 139,692,426 (GRCm39) T107K probably benign Het
Ehmt2 C T 17: 35,118,067 (GRCm39) R40* probably null Het
Ergic1 G A 17: 26,843,580 (GRCm39) V17I probably damaging Het
Fank1 G T 7: 133,478,569 (GRCm39) C210F probably damaging Het
Fbxo15 T G 18: 84,978,194 (GRCm39) M136R probably damaging Het
Ggcx C A 6: 72,401,017 (GRCm39) P240H probably damaging Het
Gpr179 T C 11: 97,227,608 (GRCm39) R1516G probably benign Het
Gprin3 G A 6: 59,330,931 (GRCm39) Q459* probably null Het
Hadha C A 5: 30,350,252 (GRCm39) V99F possibly damaging Het
Hirip3 A G 7: 126,463,034 (GRCm39) D330G possibly damaging Het
Kansl1l T C 1: 66,841,271 (GRCm39) T10A probably benign Het
Kcnd2 T C 6: 21,723,211 (GRCm39) I467T probably benign Het
Klc3 A T 7: 19,130,932 (GRCm39) I215N probably damaging Het
Kmt2c A G 5: 25,504,337 (GRCm39) V3657A probably benign Het
Lin28b A T 10: 45,345,164 (GRCm39) L54* probably null Het
Mgll T C 6: 88,702,743 (GRCm39) V14A probably benign Het
Mrc2 A G 11: 105,234,408 (GRCm39) N976S probably benign Het
Myh8 C A 11: 67,196,788 (GRCm39) A1807E possibly damaging Het
Nalcn G A 14: 123,647,155 (GRCm39) P573S probably damaging Het
Ncam2 C T 16: 81,231,766 (GRCm39) R77* probably null Het
Neb T C 2: 52,168,827 (GRCm39) S1903G probably benign Het
Nfe2 T A 15: 103,157,556 (GRCm39) D145V probably damaging Het
Or52a20 T A 7: 103,366,687 (GRCm39) Y295* probably null Het
Padi1 A T 4: 140,542,164 (GRCm39) V586D probably damaging Het
Pcdh12 T C 18: 38,416,192 (GRCm39) D311G probably damaging Het
Pcdha11 A T 18: 37,145,439 (GRCm39) H510L probably damaging Het
Plcb1 C A 2: 135,102,486 (GRCm39) P221H probably benign Het
Plekhg2 A T 7: 28,069,856 (GRCm39) V58E probably damaging Het
Pparg A C 6: 115,467,032 (GRCm39) Q435P probably damaging Het
Ppp1r36 A G 12: 76,484,892 (GRCm39) T282A possibly damaging Het
Prcd T C 11: 116,559,110 (GRCm39) probably benign Het
Pygo1 A T 9: 72,852,266 (GRCm39) H151L possibly damaging Het
Rnmt A G 18: 68,446,773 (GRCm39) Y266C probably benign Het
Rxrb T C 17: 34,255,411 (GRCm39) V246A probably damaging Het
Sart1 A G 19: 5,433,704 (GRCm39) S378P probably damaging Het
Sema4d T C 13: 51,865,390 (GRCm39) N318S possibly damaging Het
Sis C T 3: 72,798,754 (GRCm39) V1765I probably benign Het
Slc17a6 A T 7: 51,276,598 (GRCm39) K116* probably null Het
Smc6 T A 12: 11,341,540 (GRCm39) H519Q probably benign Het
Sowahc T A 10: 59,058,785 (GRCm39) M307K probably benign Het
Sptbn1 A G 11: 30,087,560 (GRCm39) Y960H probably damaging Het
Tmem270 A C 5: 134,931,636 (GRCm39) V102G probably benign Het
Tmprss11d A G 5: 86,486,729 (GRCm39) F54L probably benign Het
Top1 T A 2: 160,544,695 (GRCm39) Y270* probably null Het
Trpm2 A G 10: 77,771,795 (GRCm39) F615L probably benign Het
Ttf2 A G 3: 100,866,558 (GRCm39) S525P probably damaging Het
Ttn A T 2: 76,777,241 (GRCm39) M1387K possibly damaging Het
Upk3bl A T 5: 136,088,954 (GRCm39) R156W probably damaging Het
Usp34 G T 11: 23,299,198 (GRCm39) R290L probably benign Het
Vwf T C 6: 125,620,005 (GRCm39) V1561A Het
Zan A G 5: 137,420,155 (GRCm39) I2834T unknown Het
Zfp105 A G 9: 122,755,454 (GRCm39) Y90C probably benign Het
Zfp804a T C 2: 82,089,339 (GRCm39) V1056A probably damaging Het
Zfp956 A T 6: 47,930,455 (GRCm39) probably benign Het
Other mutations in Irx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Irx2 APN 13 72,779,429 (GRCm39) missense probably damaging 1.00
R0647:Irx2 UTSW 13 72,778,799 (GRCm39) missense probably damaging 1.00
R0783:Irx2 UTSW 13 72,780,769 (GRCm39) critical splice donor site probably null
R0931:Irx2 UTSW 13 72,779,675 (GRCm39) missense possibly damaging 0.71
R0932:Irx2 UTSW 13 72,779,675 (GRCm39) missense possibly damaging 0.71
R1782:Irx2 UTSW 13 72,779,585 (GRCm39) missense probably benign 0.19
R2844:Irx2 UTSW 13 72,779,709 (GRCm39) missense probably damaging 1.00
R4656:Irx2 UTSW 13 72,779,417 (GRCm39) missense probably damaging 1.00
R4963:Irx2 UTSW 13 72,780,729 (GRCm39) missense possibly damaging 0.71
R5219:Irx2 UTSW 13 72,779,420 (GRCm39) missense probably damaging 1.00
R6663:Irx2 UTSW 13 72,777,248 (GRCm39) missense probably damaging 1.00
R7311:Irx2 UTSW 13 72,779,396 (GRCm39) missense probably damaging 0.98
R7411:Irx2 UTSW 13 72,777,182 (GRCm39) start codon destroyed probably null 0.99
R7487:Irx2 UTSW 13 72,778,739 (GRCm39) missense probably damaging 1.00
R7506:Irx2 UTSW 13 72,777,328 (GRCm39) missense probably damaging 1.00
R7792:Irx2 UTSW 13 72,779,493 (GRCm39) missense possibly damaging 0.88
R7953:Irx2 UTSW 13 72,777,343 (GRCm39) missense probably benign 0.02
R9083:Irx2 UTSW 13 72,777,392 (GRCm39) missense possibly damaging 0.94
Z1177:Irx2 UTSW 13 72,777,208 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGCCTTGTGCGAATCAG -3'
(R):5'- TGTGTAGTTGCCATAGAAAGGG -3'

Sequencing Primer
(F):5'- CTTGTGCGAATCAGGCTCAGAG -3'
(R):5'- TTGCCATAGAAAGGGGACGTG -3'
Posted On 2016-10-05