Incidental Mutation 'R5524:Lcorl'
ID431739
Institutional Source Beutler Lab
Gene Symbol Lcorl
Ensembl Gene ENSMUSG00000015882
Gene Nameligand dependent nuclear receptor corepressor-like
SynonymsMlr1, A830039H10Rik
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45697181-45857615 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 45775522 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016026] [ENSMUST00000016026] [ENSMUST00000045586] [ENSMUST00000045586] [ENSMUST00000087164] [ENSMUST00000087164] [ENSMUST00000121573] [ENSMUST00000121573] [ENSMUST00000186633] [ENSMUST00000189859] [ENSMUST00000189859] [ENSMUST00000190036] [ENSMUST00000190036]
Predicted Effect probably null
Transcript: ENSMUST00000016026
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000016026
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067997
Predicted Effect probably null
Transcript: ENSMUST00000087164
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087164
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156295
Predicted Effect probably benign
Transcript: ENSMUST00000186633
Predicted Effect probably benign
Transcript: ENSMUST00000187615
Predicted Effect probably null
Transcript: ENSMUST00000189859
SMART Domains Protein: ENSMUSP00000139996
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
Blast:ZnF_C2H2 16 38 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000189859
SMART Domains Protein: ENSMUSP00000139996
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
Blast:ZnF_C2H2 16 38 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000190036
Predicted Effect probably null
Transcript: ENSMUST00000190036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200385
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Lcorl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Lcorl APN 5 45747295 missense probably damaging 1.00
IGL01611:Lcorl APN 5 45747092 missense probably damaging 1.00
IGL03014:Lcorl UTSW 5 45774029 intron probably benign
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0499:Lcorl UTSW 5 45734369 missense probably benign 0.00
R1518:Lcorl UTSW 5 45734201 missense possibly damaging 0.94
R1817:Lcorl UTSW 5 45795346 missense probably damaging 1.00
R1977:Lcorl UTSW 5 45775420 missense probably null 0.16
R2171:Lcorl UTSW 5 45747151 missense probably damaging 0.99
R3737:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3738:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3739:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3825:Lcorl UTSW 5 45775387 splice site probably benign
R4035:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R4199:Lcorl UTSW 5 45733788 missense possibly damaging 0.83
R4583:Lcorl UTSW 5 45733589 nonsense probably null
R4647:Lcorl UTSW 5 45733589 nonsense probably null
R4803:Lcorl UTSW 5 45747281 unclassified probably null
R5524:Lcorl UTSW 5 45775523 critical splice acceptor site probably null
R5526:Lcorl UTSW 5 45733727 missense probably benign
R5533:Lcorl UTSW 5 45733877 missense possibly damaging 0.47
R5772:Lcorl UTSW 5 45795367 splice site probably null
R5927:Lcorl UTSW 5 45725424 intron probably benign
R6175:Lcorl UTSW 5 45776490 missense probably damaging 1.00
R6734:Lcorl UTSW 5 45733497 missense probably damaging 0.98
R6864:Lcorl UTSW 5 45747204 missense probably damaging 1.00
R7078:Lcorl UTSW 5 45747224 missense probably damaging 1.00
R7396:Lcorl UTSW 5 45857459 splice site probably null
R7624:Lcorl UTSW 5 45701965 missense probably benign
X0023:Lcorl UTSW 5 45734012 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGACACTCTTATTGGCTC -3'
(R):5'- GCATAAACTTTTCGGCAGTGCC -3'

Sequencing Primer
(F):5'- GACACTCTTATTGGCTCTAGTAAGAC -3'
(R):5'- TGGGATTTTATGAAAGGCAG -3'
Posted On2016-10-05