Incidental Mutation 'R5524:Zim1'
ID431746
Institutional Source Beutler Lab
Gene Symbol Zim1
Ensembl Gene ENSMUSG00000002266
Gene Namezinc finger, imprinted 1
Synonyms
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6671269-6696450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6677321 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 448 (N448D)
Ref Sequence ENSEMBL: ENSMUSP00000145453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002336] [ENSMUST00000122432] [ENSMUST00000203908]
Predicted Effect probably benign
Transcript: ENSMUST00000002336
AA Change: N448D

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002336
Gene: ENSMUSG00000002266
AA Change: N448D

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122432
AA Change: N448D

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113585
Gene: ENSMUSG00000002266
AA Change: N448D

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203908
AA Change: N448D

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145453
Gene: ENSMUSG00000002266
AA Change: N448D

DomainStartEndE-ValueType
KRAB 50 110 5.78e-29 SMART
low complexity region 189 203 N/A INTRINSIC
low complexity region 215 234 N/A INTRINSIC
ZnF_C2H2 269 291 5.59e-4 SMART
ZnF_C2H2 297 319 2.05e-2 SMART
ZnF_C2H2 325 347 1.4e-4 SMART
ZnF_C2H2 353 375 8.6e-5 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 2.71e-2 SMART
ZnF_C2H2 437 459 6.88e-4 SMART
ZnF_C2H2 465 487 6.32e-3 SMART
ZnF_C2H2 493 515 1.56e-2 SMART
ZnF_C2H2 521 543 3.95e-4 SMART
ZnF_C2H2 549 571 7.49e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Other mutations in Zim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Zim1 APN 7 6682760 missense possibly damaging 0.95
IGL01921:Zim1 APN 7 6682185 splice site probably benign
IGL02116:Zim1 APN 7 6678254 missense probably benign 0.00
IGL02252:Zim1 APN 7 6688628 missense unknown
IGL02354:Zim1 APN 7 6682874 splice site probably null
IGL02361:Zim1 APN 7 6682874 splice site probably null
IGL03025:Zim1 APN 7 6682059 missense probably benign 0.00
R0003:Zim1 UTSW 7 6676948 missense probably benign 0.01
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1347:Zim1 UTSW 7 6677431 missense probably damaging 1.00
R1483:Zim1 UTSW 7 6682125 missense probably benign 0.00
R2106:Zim1 UTSW 7 6678074 missense probably benign 0.02
R2315:Zim1 UTSW 7 6677068 missense possibly damaging 0.86
R2508:Zim1 UTSW 7 6677430 small insertion probably benign
R2508:Zim1 UTSW 7 6677431 small insertion probably benign
R3706:Zim1 UTSW 7 6677291 missense probably damaging 0.97
R3975:Zim1 UTSW 7 6677130 missense probably damaging 1.00
R5557:Zim1 UTSW 7 6677711 missense probably damaging 1.00
R5843:Zim1 UTSW 7 6677698 missense possibly damaging 0.59
R5844:Zim1 UTSW 7 6678116 missense probably benign 0.21
R5882:Zim1 UTSW 7 6682738 critical splice donor site probably null
R6828:Zim1 UTSW 7 6677689 missense probably damaging 1.00
R6953:Zim1 UTSW 7 6687707 missense unknown
R7080:Zim1 UTSW 7 6677306 missense possibly damaging 0.92
R7148:Zim1 UTSW 7 6678221 missense possibly damaging 0.91
R7199:Zim1 UTSW 7 6677873 nonsense probably null
R7332:Zim1 UTSW 7 6677353 missense probably damaging 1.00
R7462:Zim1 UTSW 7 6677812 missense probably damaging 1.00
Z1088:Zim1 UTSW 7 6677659 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CATCTGAAAGTCTTTCCACACC -3'
(R):5'- ATGCGGGAAAACCTTCAACC -3'

Sequencing Primer
(F):5'- GAAAGTCTTTCCACACCCCTTG -3'
(R):5'- ACCCTTTAAATGTGACGAGTGCG -3'
Posted On2016-10-05