Incidental Mutation 'R5524:Ces2g'
ID431753
Institutional Source Beutler Lab
Gene Symbol Ces2g
Ensembl Gene ENSMUSG00000031877
Gene Namecarboxylesterase 2G
Synonyms2210023G05Rik
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location104961718-104969537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104966895 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 403 (T403A)
Ref Sequence ENSEMBL: ENSMUSP00000049315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043183]
Predicted Effect probably benign
Transcript: ENSMUST00000043183
AA Change: T403A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000049315
Gene: ENSMUSG00000031877
AA Change: T403A

DomainStartEndE-ValueType
Pfam:COesterase 11 539 1.4e-176 PFAM
Pfam:Abhydrolase_3 144 245 4.9e-11 PFAM
Pfam:Peptidase_S9 159 331 8.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212330
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Olfr44 C T 9: 39,484,987 V89M probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Ces2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ces2g APN 8 104967839 splice site probably benign
IGL00901:Ces2g APN 8 104965129 missense probably benign 0.01
IGL02101:Ces2g APN 8 104965137 splice site probably null
IGL02146:Ces2g APN 8 104966944 missense possibly damaging 0.94
IGL02624:Ces2g APN 8 104964748 missense probably damaging 1.00
IGL03091:Ces2g APN 8 104964754 missense probably damaging 1.00
PIT4810001:Ces2g UTSW 8 104964889 missense possibly damaging 0.52
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0025:Ces2g UTSW 8 104965996 splice site probably benign
R0122:Ces2g UTSW 8 104968300 missense probably damaging 0.96
R0494:Ces2g UTSW 8 104966567 missense probably benign
R1127:Ces2g UTSW 8 104967462 splice site probably null
R1337:Ces2g UTSW 8 104963965 missense possibly damaging 0.63
R1619:Ces2g UTSW 8 104967352 missense probably damaging 1.00
R1813:Ces2g UTSW 8 104966937 missense probably benign 0.32
R2240:Ces2g UTSW 8 104962502 missense probably benign 0.11
R2255:Ces2g UTSW 8 104967414 missense probably damaging 1.00
R2307:Ces2g UTSW 8 104968412 missense probably benign 0.01
R2566:Ces2g UTSW 8 104965989 critical splice donor site probably null
R4026:Ces2g UTSW 8 104964745 missense probably damaging 0.99
R4469:Ces2g UTSW 8 104965970 missense probably benign 0.14
R4631:Ces2g UTSW 8 104967462 splice site probably null
R4859:Ces2g UTSW 8 104967462 splice site probably null
R4900:Ces2g UTSW 8 104967357 nonsense probably null
R4925:Ces2g UTSW 8 104964894 missense probably benign 0.27
R5556:Ces2g UTSW 8 104967442 missense probably benign 0.14
R6795:Ces2g UTSW 8 104967817 missense probably damaging 0.96
R6988:Ces2g UTSW 8 104963908 missense probably benign
R7653:Ces2g UTSW 8 104962653 missense probably damaging 1.00
R7724:Ces2g UTSW 8 104966852 missense probably benign 0.02
R7740:Ces2g UTSW 8 104966330 missense probably damaging 0.98
R7856:Ces2g UTSW 8 104966382 missense not run
R8123:Ces2g UTSW 8 104966923 missense probably benign 0.06
Z1177:Ces2g UTSW 8 104963961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACCTCAGAGCAAGAAC -3'
(R):5'- GTATCAGCAACCCATTTTCGC -3'

Sequencing Primer
(F):5'- GGTCACCTCAGAGCAAGAACTTTTTC -3'
(R):5'- ACCCAGATTTCACTCTCTTAAACTAG -3'
Posted On2016-10-05