Incidental Mutation 'R5524:Olfr44'
ID431754
Institutional Source Beutler Lab
Gene Symbol Olfr44
Ensembl Gene ENSMUSG00000062649
Gene Nameolfactory receptor 44
SynonymsGA_x6K02T2PVTD-33181773-33180838, MOR171-5, IB3
MMRRC Submission 043082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5524 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39481786-39493995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39484987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 89 (V89M)
Ref Sequence ENSEMBL: ENSMUSP00000076935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077757] [ENSMUST00000215065] [ENSMUST00000216316]
Predicted Effect probably damaging
Transcript: ENSMUST00000077757
AA Change: V89M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076935
Gene: ENSMUSG00000062649
AA Change: V89M

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.1e-50 PFAM
Pfam:7tm_1 44 293 1.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215065
AA Change: V86M

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216316
AA Change: V86M

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010L04Rik T A 7: 82,853,942 noncoding transcript Het
6030469F06Rik A G 12: 31,184,863 noncoding transcript Het
A830031A19Rik T A 11: 24,058,776 I13F unknown Het
Acsbg2 A C 17: 56,850,197 L309R probably damaging Het
Adam32 A T 8: 24,922,312 M76K probably damaging Het
Adamts14 C A 10: 61,230,443 R297L probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Asb14 A G 14: 26,900,451 K80E possibly damaging Het
Baiap2l1 T C 5: 144,280,949 T276A probably benign Het
Cacna1d G A 14: 30,042,129 P2127S probably benign Het
Ces2g A G 8: 104,966,895 T403A probably benign Het
Cgn A C 3: 94,779,989 M1R probably null Het
Chd5 T G 4: 152,376,630 S1226A probably benign Het
Col18a1 A G 10: 77,058,724 V1497A probably damaging Het
Cpd A T 11: 76,797,901 Y848* probably null Het
Cyp2a12 T C 7: 27,031,231 V207A probably benign Het
Cyth1 G A 11: 118,182,767 R247W probably benign Het
Derl3 T C 10: 75,894,490 V129A possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eml1 A T 12: 108,521,376 I518L probably damaging Het
Eri1 A G 8: 35,478,609 V174A probably benign Het
Fgd3 T A 13: 49,277,577 I435F probably damaging Het
Foxd1 T G 13: 98,355,904 S429A unknown Het
Ftcd T A 10: 76,589,331 probably benign Het
Gm5478 G T 15: 101,644,667 N323K probably benign Het
Gnpda1 G T 18: 38,335,108 P45Q probably damaging Het
Kif20a G T 18: 34,630,625 probably null Het
Klrb1 T C 6: 128,712,333 probably null Het
Lcorl C A 5: 45,775,522 probably null Het
Lcorl T A 5: 45,775,523 probably null Het
Lrp1b T A 2: 41,110,888 K2108M probably damaging Het
Lyst C T 13: 13,746,779 P3437S probably benign Het
Macrod2 A T 2: 142,317,943 M349L possibly damaging Het
March7 T C 2: 60,245,303 probably benign Het
Mcm9 A T 10: 53,548,690 C601* probably null Het
Muc19 G T 15: 91,894,393 noncoding transcript Het
Mycbp2 T C 14: 103,295,237 D427G probably damaging Het
Nap1l5 C A 6: 58,906,778 V64L possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Npas3 T C 12: 54,068,938 V863A possibly damaging Het
Nr2c2 T A 6: 92,139,765 probably null Het
Olfr181 C T 16: 58,925,809 C254Y probably benign Het
Olfr43 A T 11: 74,206,583 L211Q probably damaging Het
Oosp3 T C 19: 11,705,430 F56S possibly damaging Het
Plgrkt G A 19: 29,350,450 P78S probably damaging Het
Prss36 G A 7: 127,934,465 Q56* probably null Het
Ptprz1 A G 6: 22,986,318 probably null Het
Qsox2 A T 2: 26,217,687 F265I probably damaging Het
R3hcc1l G T 19: 42,563,868 E435* probably null Het
Shbg T C 11: 69,616,762 D163G probably benign Het
Skint7 T A 4: 111,980,349 L108H probably damaging Het
Smtnl1 T A 2: 84,818,894 E5D probably benign Het
Spock1 C T 13: 57,556,795 G120D probably damaging Het
Stk11ip G T 1: 75,532,327 C700F probably damaging Het
Sult4a1 C T 15: 84,089,958 probably null Het
Syngap1 A G 17: 26,957,152 H138R probably damaging Het
Tdrd7 A G 4: 46,034,301 K1016E probably benign Het
Tmem167b T C 3: 108,560,253 K26E possibly damaging Het
Tnfaip3 A G 10: 19,008,195 S146P probably damaging Het
Ttn C T 2: 76,776,716 V16242I possibly damaging Het
Vmn2r-ps3 T A 3: 64,053,449 noncoding transcript Het
Vps13c T C 9: 67,957,556 F3049S probably damaging Het
Vstm2l T C 2: 157,935,435 W78R probably damaging Het
Wbp1l C A 19: 46,654,256 A216D possibly damaging Het
Zer1 C G 2: 30,104,854 V510L probably damaging Het
Zfp28 A T 7: 6,394,851 probably null Het
Zfp352 C A 4: 90,225,104 P494T possibly damaging Het
Zfp353-ps A G 8: 42,082,563 noncoding transcript Het
Zfp563 A T 17: 33,102,541 probably null Het
Zim1 T C 7: 6,677,321 N448D probably benign Het
Other mutations in Olfr44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr44 APN 9 39484648 missense probably benign 0.02
IGL02239:Olfr44 APN 9 39484561 missense probably damaging 1.00
IGL02305:Olfr44 APN 9 39485037 missense probably damaging 0.97
IGL02353:Olfr44 APN 9 39485148 missense probably benign
IGL02360:Olfr44 APN 9 39485148 missense probably benign
R0212:Olfr44 UTSW 9 39485088 missense probably damaging 1.00
R0600:Olfr44 UTSW 9 39484988 missense probably benign 0.34
R1329:Olfr44 UTSW 9 39484444 missense probably damaging 0.97
R1348:Olfr44 UTSW 9 39485236 missense probably benign
R1594:Olfr44 UTSW 9 39484746 missense probably benign 0.03
R5017:Olfr44 UTSW 9 39484755 missense possibly damaging 0.90
R5141:Olfr44 UTSW 9 39484531 missense probably damaging 1.00
R5244:Olfr44 UTSW 9 39484512 missense probably damaging 1.00
R5630:Olfr44 UTSW 9 39484951 missense probably benign 0.00
R5860:Olfr44 UTSW 9 39484471 missense probably benign 0.07
R6444:Olfr44 UTSW 9 39484318 missense probably benign 0.04
R6649:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R6653:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R7115:Olfr44 UTSW 9 39484648 missense probably benign 0.02
R7595:Olfr44 UTSW 9 39484315 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAAGCCTGTGTGAGCTGATG -3'
(R):5'- AGAGAAGCCAGAACTCCAGCTG -3'

Sequencing Primer
(F):5'- GATCACACCAATAATATACACTCCTG -3'
(R):5'- GAACTCCAGCTGCCCCTC -3'
Posted On2016-10-05