Mutagenetix > Incidental Mutation

Incidental Mutation 'R5524:Eml1'

431768

Institutional Source

Beutler Lab

Gene Symbol

Eml1

Ensembl Gene

ENSMUSG00000058070

Gene Name

echinoderm microtubule associated protein like 1

Synonyms

A930030P13Rik, ELP79, 1110008N23Rik

MMRRC Submission

043082-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R5524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108370957-108539617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108521376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 518 (I518L)

Ref Sequence

ENSEMBL: ENSMUSP00000118325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]

AlphaFold

Q05BC3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054955
AA Change: I487L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: I487L

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	228	277	5.6e-3	SMART
WD40	280	325	2.21e1	SMART
WD40	328	367	4.46e-1	SMART
WD40	375	413	5.73e0	SMART
WD40	416	456	5.75e-1	SMART
WD40	496	539	4.24e-3	SMART
WD40	542	580	1.37e2	SMART
WD40	583	622	1.7e-2	SMART
WD40	629	668	1.58e-2	SMART
Blast:WD40	694	735	7e-20	BLAST
WD40	741	781	2.96e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109857
AA Change: I504L

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: I504L

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	245	294	5.6e-3	SMART
WD40	297	342	2.21e1	SMART
WD40	345	384	4.46e-1	SMART
WD40	392	430	5.73e0	SMART
WD40	433	473	5.75e-1	SMART
WD40	513	556	4.24e-3	SMART
WD40	559	597	1.37e2	SMART
WD40	600	639	1.7e-2	SMART
WD40	646	685	1.58e-2	SMART
Blast:WD40	711	752	7e-20	BLAST
WD40	758	798	2.96e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109860
AA Change: I518L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: I518L

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
Pfam:HELP	184	258	1.8e-35	PFAM
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART
WD40	660	699	1.58e-2	SMART
Blast:WD40	725	766	7e-20	BLAST
WD40	772	812	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130999
AA Change: I518L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070
AA Change: I518L

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155544

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.4%
20x: 91.4%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010L04Rik	T	A	7: 82,853,942		noncoding transcript	Het
6030469F06Rik	A	G	12: 31,184,863		noncoding transcript	Het
A830031A19Rik	T	A	11: 24,058,776	I13F	unknown	Het
Acsbg2	A	C	17: 56,850,197	L309R	probably damaging	Het
Adam32	A	T	8: 24,922,312	M76K	probably damaging	Het
Adamts14	C	A	10: 61,230,443	R297L	probably damaging	Het
Agbl5	G	A	5: 30,893,903		probably null	Het
Asb14	A	G	14: 26,900,451	K80E	possibly damaging	Het
Baiap2l1	T	C	5: 144,280,949	T276A	probably benign	Het
Cacna1d	G	A	14: 30,042,129	P2127S	probably benign	Het
Ces2g	A	G	8: 104,966,895	T403A	probably benign	Het
Cgn	A	C	3: 94,779,989	M1R	probably null	Het
Chd5	T	G	4: 152,376,630	S1226A	probably benign	Het
Col18a1	A	G	10: 77,058,724	V1497A	probably damaging	Het
Cpd	A	T	11: 76,797,901	Y848*	probably null	Het
Cyp2a12	T	C	7: 27,031,231	V207A	probably benign	Het
Cyth1	G	A	11: 118,182,767	R247W	probably benign	Het
Derl3	T	C	10: 75,894,490	V129A	possibly damaging	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Eri1	A	G	8: 35,478,609	V174A	probably benign	Het
Fgd3	T	A	13: 49,277,577	I435F	probably damaging	Het
Foxd1	T	G	13: 98,355,904	S429A	unknown	Het
Ftcd	T	A	10: 76,589,331		probably benign	Het
Gm5478	G	T	15: 101,644,667	N323K	probably benign	Het
Gnpda1	G	T	18: 38,335,108	P45Q	probably damaging	Het
Kif20a	G	T	18: 34,630,625		probably null	Het
Klrb1	T	C	6: 128,712,333		probably null	Het
Lcorl	C	A	5: 45,775,522		probably null	Het
Lcorl	T	A	5: 45,775,523		probably null	Het
Lrp1b	T	A	2: 41,110,888	K2108M	probably damaging	Het
Lyst	C	T	13: 13,746,779	P3437S	probably benign	Het
Macrod2	A	T	2: 142,317,943	M349L	possibly damaging	Het
March7	T	C	2: 60,245,303		probably benign	Het
Mcm9	A	T	10: 53,548,690	C601*	probably null	Het
Muc19	G	T	15: 91,894,393		noncoding transcript	Het
Mycbp2	T	C	14: 103,295,237	D427G	probably damaging	Het
Nap1l5	C	A	6: 58,906,778	V64L	possibly damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Npas3	T	C	12: 54,068,938	V863A	possibly damaging	Het
Nr2c2	T	A	6: 92,139,765		probably null	Het
Olfr181	C	T	16: 58,925,809	C254Y	probably benign	Het
Olfr43	A	T	11: 74,206,583	L211Q	probably damaging	Het
Olfr44	C	T	9: 39,484,987	V89M	probably damaging	Het
Oosp3	T	C	19: 11,705,430	F56S	possibly damaging	Het
Plgrkt	G	A	19: 29,350,450	P78S	probably damaging	Het
Prss36	G	A	7: 127,934,465	Q56*	probably null	Het
Ptprz1	A	G	6: 22,986,318		probably null	Het
Qsox2	A	T	2: 26,217,687	F265I	probably damaging	Het
R3hcc1l	G	T	19: 42,563,868	E435*	probably null	Het
Shbg	T	C	11: 69,616,762	D163G	probably benign	Het
Skint7	T	A	4: 111,980,349	L108H	probably damaging	Het
Smtnl1	T	A	2: 84,818,894	E5D	probably benign	Het
Spock1	C	T	13: 57,556,795	G120D	probably damaging	Het
Stk11ip	G	T	1: 75,532,327	C700F	probably damaging	Het
Sult4a1	C	T	15: 84,089,958		probably null	Het
Syngap1	A	G	17: 26,957,152	H138R	probably damaging	Het
Tdrd7	A	G	4: 46,034,301	K1016E	probably benign	Het
Tmem167b	T	C	3: 108,560,253	K26E	possibly damaging	Het
Tnfaip3	A	G	10: 19,008,195	S146P	probably damaging	Het
Ttn	C	T	2: 76,776,716	V16242I	possibly damaging	Het
Vmn2r-ps3	T	A	3: 64,053,449		noncoding transcript	Het
Vps13c	T	C	9: 67,957,556	F3049S	probably damaging	Het
Vstm2l	T	C	2: 157,935,435	W78R	probably damaging	Het
Wbp1l	C	A	19: 46,654,256	A216D	possibly damaging	Het
Zer1	C	G	2: 30,104,854	V510L	probably damaging	Het
Zfp28	A	T	7: 6,394,851		probably null	Het
Zfp352	C	A	4: 90,225,104	P494T	possibly damaging	Het
Zfp353-ps	A	G	8: 42,082,563		noncoding transcript	Het
Zfp563	A	T	17: 33,102,541		probably null	Het
Zim1	T	C	7: 6,677,321	N448D	probably benign	Het

Other mutations in Eml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Eml1	APN	12	108514515	splice site	probably null
IGL00774:Eml1	APN	12	108514515	splice site	probably null
IGL01358:Eml1	APN	12	108514468	missense	probably benign	0.05
IGL02316:Eml1	APN	12	108534759	intron	probably benign
IGL02346:Eml1	APN	12	108537441	missense	possibly damaging	0.87
IGL02480:Eml1	APN	12	108521696	missense	probably benign	0.32
IGL02513:Eml1	APN	12	108530312	missense	probably damaging	1.00
IGL02556:Eml1	APN	12	108537366	missense	probably benign	0.00
IGL02565:Eml1	APN	12	108506520	missense	probably damaging	1.00
IGL03217:Eml1	APN	12	108534942	missense	probably benign	0.31
bubble	UTSW	12	108513071	critical splice donor site	probably null
R0027:Eml1	UTSW	12	108536298	missense	possibly damaging	0.90
R0067:Eml1	UTSW	12	108463527	missense	possibly damaging	0.61
R0124:Eml1	UTSW	12	108506608	missense	probably benign	0.00
R0124:Eml1	UTSW	12	108509178	missense	probably damaging	1.00
R0730:Eml1	UTSW	12	108530326	missense	possibly damaging	0.79
R1566:Eml1	UTSW	12	108471892	missense	probably damaging	0.99
R1883:Eml1	UTSW	12	108463652	missense	probably damaging	0.97
R1927:Eml1	UTSW	12	108538217	nonsense	probably null
R1938:Eml1	UTSW	12	108521396	missense	possibly damaging	0.75
R2070:Eml1	UTSW	12	108512999	missense	probably damaging	1.00
R2311:Eml1	UTSW	12	108537416	missense	probably damaging	0.99
R2417:Eml1	UTSW	12	108536275	missense	probably benign	0.00
R3120:Eml1	UTSW	12	108513053	missense	probably benign	0.31
R4352:Eml1	UTSW	12	108534837	intron	probably benign
R4471:Eml1	UTSW	12	108506635	intron	probably benign
R4655:Eml1	UTSW	12	108534713	missense	probably damaging	1.00
R5077:Eml1	UTSW	12	108506612	splice site	probably benign
R5094:Eml1	UTSW	12	108536311	missense	probably benign	0.11
R5113:Eml1	UTSW	12	108537337	missense	possibly damaging	0.74
R5775:Eml1	UTSW	12	108506554	missense	probably damaging	1.00
R6120:Eml1	UTSW	12	108527724	missense	probably damaging	1.00
R6224:Eml1	UTSW	12	108514508	missense	probably damaging	1.00
R6491:Eml1	UTSW	12	108513071	critical splice donor site	probably null
R7035:Eml1	UTSW	12	108509234	missense	probably damaging	1.00
R7134:Eml1	UTSW	12	108506551	missense	probably benign	0.00
R7273:Eml1	UTSW	12	108538173	missense	possibly damaging	0.87
R7606:Eml1	UTSW	12	108537366	missense	probably benign	0.45
R7744:Eml1	UTSW	12	108516604	missense	probably benign
R7820:Eml1	UTSW	12	108515174	missense	possibly damaging	0.81
R8013:Eml1	UTSW	12	108521679	missense	probably benign	0.18
R8223:Eml1	UTSW	12	108536310	missense	probably benign	0.00
R8258:Eml1	UTSW	12	108510199	missense	probably damaging	0.97
R8259:Eml1	UTSW	12	108510199	missense	probably damaging	0.97
R8399:Eml1	UTSW	12	108538131	missense	possibly damaging	0.91
R8427:Eml1	UTSW	12	108530321	missense	probably damaging	0.99
R9002:Eml1	UTSW	12	108538179	missense	probably damaging	1.00
R9220:Eml1	UTSW	12	108514443	nonsense	probably null
R9432:Eml1	UTSW	12	108516583	missense	probably benign	0.00
R9446:Eml1	UTSW	12	108515206	missense	probably damaging	0.98
R9500:Eml1	UTSW	12	108527699	missense	probably damaging	1.00
Z1088:Eml1	UTSW	12	108537459	missense	possibly damaging	0.80
Z1177:Eml1	UTSW	12	108423139	start gained	probably benign
Z1177:Eml1	UTSW	12	108534656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTATCACAAGAGCTATCACG -3'
(R):5'- AAGGACCGTCTCATGAGCTC -3'

Sequencing Primer
(F):5'- CTGTAATCCTAGCACTTGGGAGAC -3'
(R):5'- TCTCAAGCTTAATCATGCCACAG -3'

Posted On

2016-10-05