Incidental Mutation 'R0469:Taf6l'
ID43179
Institutional Source Beutler Lab
Gene Symbol Taf6l
Ensembl Gene ENSMUSG00000003680
Gene NameTATA-box binding protein associated factor 6 like
SynonymsPAF65A, 2810417N14Rik, C530024J06Rik
MMRRC Submission 038669-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0469 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8772522-8786417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8778521 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 254 (H254Q)
Ref Sequence ENSEMBL: ENSMUSP00000140136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]
Predicted Effect probably benign
Transcript: ENSMUST00000003777
AA Change: H279Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680
AA Change: H279Q

DomainStartEndE-ValueType
TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010249
SMART Domains Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176331
Predicted Effect probably benign
Transcript: ENSMUST00000176496
AA Change: H255Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680
AA Change: H255Q

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176610
AA Change: H280Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680
AA Change: H280Q

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176991
Predicted Effect probably benign
Transcript: ENSMUST00000177056
AA Change: H273Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680
AA Change: H273Q

DomainStartEndE-ValueType
TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177216
AA Change: H280Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680
AA Change: H280Q

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189739
AA Change: H254Q

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680
AA Change: H254Q

DomainStartEndE-ValueType
TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0760 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
B3gntl1 A T 11: 121,673,025 V3D probably benign Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Golgb1 A G 16: 36,931,635 I3144V probably benign Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr338 A T 2: 36,377,462 I229F probably benign Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rbmx C T X: 57,391,566 probably null Het
Rbp3 A G 14: 33,962,419 K1135R possibly damaging Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tm9sf1 A T 14: 55,641,429 F169I possibly damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpr AAGAGAGAGAGAGAG AAGAGAGAGAGAG 1: 150,423,667 probably null Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Upb1 T C 10: 75,415,083 probably null Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Taf6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Taf6l APN 19 8783388 missense probably benign 0.04
IGL00781:Taf6l APN 19 8773661 missense probably damaging 1.00
IGL01886:Taf6l APN 19 8778086 critical splice donor site probably null
IGL02638:Taf6l APN 19 8775266 missense probably benign 0.03
IGL02676:Taf6l APN 19 8775049 missense probably damaging 1.00
R0096:Taf6l UTSW 19 8778517 missense probably benign 0.06
R0110:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0510:Taf6l UTSW 19 8778521 missense probably benign 0.08
R0676:Taf6l UTSW 19 8773369 missense probably benign 0.00
R0711:Taf6l UTSW 19 8778517 missense probably benign 0.06
R1804:Taf6l UTSW 19 8773634 missense probably damaging 0.99
R1971:Taf6l UTSW 19 8775502 unclassified probably null
R2869:Taf6l UTSW 19 8778628 unclassified probably benign
R2870:Taf6l UTSW 19 8778628 unclassified probably benign
R3105:Taf6l UTSW 19 8778855 missense probably damaging 1.00
R4578:Taf6l UTSW 19 8783971 missense possibly damaging 0.95
R4581:Taf6l UTSW 19 8778208 missense probably damaging 0.99
R4841:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R4842:Taf6l UTSW 19 8782406 missense possibly damaging 0.77
R5215:Taf6l UTSW 19 8778053 intron probably benign
R5269:Taf6l UTSW 19 8774962 missense probably damaging 1.00
R5571:Taf6l UTSW 19 8783930 missense probably damaging 1.00
R5687:Taf6l UTSW 19 8773312 missense probably benign 0.01
R5799:Taf6l UTSW 19 8782631 missense possibly damaging 0.93
R5814:Taf6l UTSW 19 8774846 missense probably benign 0.13
R6008:Taf6l UTSW 19 8778166 missense possibly damaging 0.65
R6091:Taf6l UTSW 19 8778556 missense probably benign 0.04
R6228:Taf6l UTSW 19 8778666 missense probably benign 0.01
R6569:Taf6l UTSW 19 8772710 missense probably damaging 1.00
R6768:Taf6l UTSW 19 8774549 missense probably damaging 1.00
R7586:Taf6l UTSW 19 8783846 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTCTGAGACAGGCTGCCAGATG -3'
(R):5'- AAATCTGTAAGCCACGACCTGGAAC -3'

Sequencing Primer
(F):5'- AGGCTGCCAGATGTGACTG -3'
(R):5'- TGGAACAACTGCACCGAC -3'
Posted On2013-05-23