Incidental Mutation 'R5525:Bzw1'
ID431793
Institutional Source Beutler Lab
Gene Symbol Bzw1
Ensembl Gene ENSMUSG00000051223
Gene Namebasic leucine zipper and W2 domains 1
Synonyms1200015E15Rik
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58392898-58407353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58402906 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 221 (E221G)
Ref Sequence ENSEMBL: ENSMUSP00000139761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050552] [ENSMUST00000186949] [ENSMUST00000188630] [ENSMUST00000188898]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050552
AA Change: E280G

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051935
Gene: ENSMUSG00000051223
AA Change: E280G

DomainStartEndE-ValueType
eIF5C 325 410 3.75e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186949
AA Change: E312G

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140319
Gene: ENSMUSG00000051223
AA Change: E312G

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
eIF5C 357 442 1.8e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188630
Predicted Effect possibly damaging
Transcript: ENSMUST00000188898
AA Change: E221G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Bzw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Bzw1 APN 1 58402942 missense possibly damaging 0.56
IGL00583:Bzw1 APN 1 58401335 splice site probably benign
IGL00816:Bzw1 APN 1 58399054 missense probably damaging 1.00
IGL01625:Bzw1 APN 1 58401440 missense probably benign 0.42
R1138:Bzw1 UTSW 1 58401386 missense probably damaging 1.00
R1229:Bzw1 UTSW 1 58394219 missense probably benign 0.45
R1272:Bzw1 UTSW 1 58397820 missense probably damaging 1.00
R1837:Bzw1 UTSW 1 58400118 missense probably damaging 1.00
R4491:Bzw1 UTSW 1 58404259 missense probably damaging 1.00
R5641:Bzw1 UTSW 1 58397724 missense probably damaging 0.98
R7794:Bzw1 UTSW 1 58400800 missense probably benign 0.00
R8214:Bzw1 UTSW 1 58405037 missense probably damaging 0.97
X0050:Bzw1 UTSW 1 58401462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAATGGAAAGCTTGGTTGG -3'
(R):5'- AGTATCCACTCAGTGCACAC -3'

Sequencing Primer
(F):5'- TCAGGCATGGACTTACTCTACAG -3'
(R):5'- CACCCCACCCCAACTGTG -3'
Posted On2016-10-05