Incidental Mutation 'R5525:Agap1'
Institutional Source Beutler Lab
Gene Symbol Agap1
Ensembl Gene ENSMUSG00000055013
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 1
SynonymsGgap1, Centg2
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosomal Location89454806-89897617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89743773 bp
Amino Acid Change Threonine to Alanine at position 401 (T401A)
Ref Sequence ENSEMBL: ENSMUSP00000140599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027521
AA Change: T401A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: T401A

Pfam:Ras 73 231 1.1e-18 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 590 1.36e-15 SMART
ArfGap 609 729 4.58e-51 SMART
ANK 768 797 1.83e-3 SMART
ANK 801 832 1.33e2 SMART
low complexity region 840 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074945
AA Change: T267A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: T267A

Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190096
AA Change: T401A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: T401A

Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Agap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Agap1 APN 1 89663796 splice site probably benign
IGL00310:Agap1 APN 1 89887670 missense probably damaging 1.00
IGL01104:Agap1 APN 1 89726075 splice site probably benign
IGL02227:Agap1 APN 1 89663775 missense probably damaging 0.99
IGL02959:Agap1 APN 1 89843191 missense possibly damaging 0.94
IGL03303:Agap1 APN 1 89665152 missense probably damaging 1.00
K3955:Agap1 UTSW 1 89887604 missense probably damaging 1.00
R0030:Agap1 UTSW 1 89888744 nonsense probably null
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0400:Agap1 UTSW 1 89843250 splice site probably benign
R1104:Agap1 UTSW 1 89789240 missense probably damaging 0.99
R1160:Agap1 UTSW 1 89843154 missense probably damaging 0.98
R1439:Agap1 UTSW 1 89843186 missense probably damaging 1.00
R1454:Agap1 UTSW 1 89837806 splice site probably null
R1644:Agap1 UTSW 1 89663730 missense probably damaging 0.97
R1984:Agap1 UTSW 1 89766323 missense probably benign
R2141:Agap1 UTSW 1 89837755 missense probably damaging 0.99
R3966:Agap1 UTSW 1 89834461 missense probably damaging 0.99
R4195:Agap1 UTSW 1 89834539 missense probably damaging 0.99
R4669:Agap1 UTSW 1 89837806 splice site probably null
R4951:Agap1 UTSW 1 89609503 missense probably damaging 1.00
R5843:Agap1 UTSW 1 89609550 missense probably damaging 0.97
R5930:Agap1 UTSW 1 89843096 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6879:Agap1 UTSW 1 89766455 missense probably benign 0.25
R7027:Agap1 UTSW 1 89888722 missense probably benign 0.00
R7207:Agap1 UTSW 1 89843099 missense possibly damaging 0.91
R7268:Agap1 UTSW 1 89766348 missense probably benign 0.02
R7289:Agap1 UTSW 1 89455431 start codon destroyed probably null 0.01
R7689:Agap1 UTSW 1 89834466 missense probably damaging 1.00
R7690:Agap1 UTSW 1 89843071 missense probably benign 0.43
R7801:Agap1 UTSW 1 89630485 missense probably damaging 1.00
R7849:Agap1 UTSW 1 89630419 missense probably damaging 0.99
R8364:Agap1 UTSW 1 89887674 missense probably damaging 1.00
RF015:Agap1 UTSW 1 89634263 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-10-05