Mutagenetix > Incidental Mutations

Incidental Mutation 'R5525:Agap1'

431795

Institutional Source

Beutler Lab

Gene Symbol

Agap1

Ensembl Gene

ENSMUSG00000055013

Gene Name

ArfGAP with GTPase domain, ankyrin repeat and PH domain 1

Synonyms

Ggap1, Centg2

MMRRC Submission

043083-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R5525 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89454806-89897617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89743773 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 401 (T401A)

Ref Sequence

ENSEMBL: ENSMUSP00000140599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027521
AA Change: T401A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: T401A

Domain	Start	End	E-Value	Type
Pfam:Ras	73	231	1.1e-18	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	590	1.36e-15	SMART
ArfGap	609	729	4.58e-51	SMART
ANK	768	797	1.83e-3	SMART
ANK	801	832	1.33e2	SMART
low complexity region	840	852	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074945
AA Change: T267A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: T267A

Domain	Start	End	E-Value	Type
Pfam:Miro	73	181	5e-24	PFAM
Pfam:Ras	73	231	3e-19	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	537	7.93e-17	SMART
ArfGap	556	676	4.58e-51	SMART
ANK	715	744	1.83e-3	SMART
ANK	748	779	1.33e2	SMART
low complexity region	787	799	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190096
AA Change: T401A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: T401A

Domain	Start	End	E-Value	Type
Pfam:Miro	73	181	5e-24	PFAM
Pfam:Ras	73	231	3e-19	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	537	7.93e-17	SMART
ArfGap	556	676	4.58e-51	SMART
ANK	715	744	1.83e-3	SMART
ANK	748	779	1.33e2	SMART
low complexity region	787	799	N/A	INTRINSIC

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,099,983	T1501A	probably benign	Het
Acin1	G	A	14: 54,664,391	A648V	possibly damaging	Het
Anapc4	T	G	5: 52,856,809	M440R	probably damaging	Het
Ankrd26	A	G	6: 118,527,731	M739T	probably benign	Het
Brip1	T	C	11: 86,110,447	E721G	possibly damaging	Het
Bzw1	A	G	1: 58,402,906	E221G	possibly damaging	Het
Cenpm	A	C	15: 82,239,291		probably null	Het
Exosc1	T	A	19: 41,924,018	K143N	probably damaging	Het
Fgd5	T	A	6: 92,066,247	L1236Q	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Grm3	C	T	5: 9,504,872	V807I	probably damaging	Het
Kndc1	A	G	7: 139,924,111	N1110S	probably benign	Het
Magi1	A	T	6: 93,792,373	V17D	possibly damaging	Het
Mdn1	T	G	4: 32,767,961	M5298R	possibly damaging	Het
Nlrp9c	T	A	7: 26,384,501	E551V	probably damaging	Het
Oacyl	A	C	18: 65,745,356	I457L	probably benign	Het
Olfr103	C	T	17: 37,336,626	G202D	probably damaging	Het
Olfr1102	A	T	2: 87,002,339	E123D	possibly damaging	Het
Olfr494	A	G	7: 108,367,999	I170V	probably benign	Het
Rab11fip3	T	C	17: 25,991,295	E996G	probably damaging	Het
Rabep1	T	A	11: 70,923,146	S554T	probably damaging	Het
Rln1	T	C	19: 29,334,520	E26G	probably benign	Het
Rpf1	A	G	3: 146,517,804		silent	Het
Sdk1	T	C	5: 142,185,265	V1961A	possibly damaging	Het
Serpinb8	A	T	1: 107,607,293	I365F	probably damaging	Het
Shank2	A	G	7: 144,070,109	D277G	probably damaging	Het
Snapc4	ACTGCTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGC	2: 26,369,526		probably benign	Het
Thsd7a	T	C	6: 12,332,007	T1269A	possibly damaging	Het
Ttll3	A	G	6: 113,412,978	N776D	probably benign	Het
Unc80	A	G	1: 66,606,614	E1483G	possibly damaging	Het
Ush2a	A	G	1: 188,753,606	D2971G	probably benign	Het
Zfp322a	A	G	13: 23,357,515	V19A	probably benign	Het
Zfp462	C	A	4: 55,050,281	P2164T	possibly damaging	Het

Other mutations in Agap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Agap1	APN	1	89663796	splice site	probably benign
IGL00310:Agap1	APN	1	89887670	missense	probably damaging	1.00
IGL01104:Agap1	APN	1	89726075	splice site	probably benign
IGL02227:Agap1	APN	1	89663775	missense	probably damaging	0.99
IGL02959:Agap1	APN	1	89843191	missense	possibly damaging	0.94
IGL03303:Agap1	APN	1	89665152	missense	probably damaging	1.00
K3955:Agap1	UTSW	1	89887604	missense	probably damaging	1.00
R0030:Agap1	UTSW	1	89888744	nonsense	probably null
R0234:Agap1	UTSW	1	89671212	missense	probably damaging	1.00
R0234:Agap1	UTSW	1	89671212	missense	probably damaging	1.00
R0400:Agap1	UTSW	1	89843250	splice site	probably benign
R1104:Agap1	UTSW	1	89789240	missense	probably damaging	0.99
R1160:Agap1	UTSW	1	89843154	missense	probably damaging	0.98
R1439:Agap1	UTSW	1	89843186	missense	probably damaging	1.00
R1454:Agap1	UTSW	1	89837806	splice site	probably null
R1644:Agap1	UTSW	1	89663730	missense	probably damaging	0.97
R1984:Agap1	UTSW	1	89766323	missense	probably benign
R2141:Agap1	UTSW	1	89837755	missense	probably damaging	0.99
R3966:Agap1	UTSW	1	89834461	missense	probably damaging	0.99
R4195:Agap1	UTSW	1	89834539	missense	probably damaging	0.99
R4669:Agap1	UTSW	1	89837806	splice site	probably null
R4951:Agap1	UTSW	1	89609503	missense	probably damaging	1.00
R5843:Agap1	UTSW	1	89609550	missense	probably damaging	0.97
R5930:Agap1	UTSW	1	89843096	missense	probably damaging	1.00
R6030:Agap1	UTSW	1	89630434	missense	probably damaging	1.00
R6030:Agap1	UTSW	1	89630434	missense	probably damaging	1.00
R6879:Agap1	UTSW	1	89766455	missense	probably benign	0.25
R7027:Agap1	UTSW	1	89888722	missense	probably benign	0.00
R7207:Agap1	UTSW	1	89843099	missense	possibly damaging	0.91
R7268:Agap1	UTSW	1	89766348	missense	probably benign	0.02
R7289:Agap1	UTSW	1	89455431	start codon destroyed	probably null	0.01
R7689:Agap1	UTSW	1	89834466	missense	probably damaging	1.00
R7690:Agap1	UTSW	1	89843071	missense	probably benign	0.43
R7801:Agap1	UTSW	1	89630485	missense	probably damaging	1.00
R7849:Agap1	UTSW	1	89630419	missense	probably damaging	0.99
R8364:Agap1	UTSW	1	89887674	missense	probably damaging	1.00
RF015:Agap1	UTSW	1	89634263	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCTCTAGATTAGGTCAGCCTG -3'
(R):5'- GATCATGGCTTCAAACCTGCC -3'

Sequencing Primer
(F):5'- GGTCAGCCTGGGTTTAAATAAAAAC -3'
(R):5'- GCTACACCATTTATCTGCAGCAGG -3'

Posted On

2016-10-05