Incidental Mutation 'R0469:Ahnak'
ID 43180
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene Name AHNAK nucleoprotein
Synonyms DY6, 1110004P15Rik, 2310047C17Rik
MMRRC Submission 038669-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R0469 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 8966648-9054278 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 8995596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 5627 (R5627*)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092956
AA Change: R5627*
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: R5627*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,125,482 (GRCm39) I67T probably damaging Het
Acoxl G A 2: 127,722,423 (GRCm39) probably null Het
Adam10 T A 9: 70,655,530 (GRCm39) W333R probably damaging Het
Alms1 A T 6: 85,597,351 (GRCm39) R1195* probably null Het
Arih2 T A 9: 108,482,291 (GRCm39) H490L possibly damaging Het
Arpc1b T A 5: 145,064,525 (GRCm39) W361R probably damaging Het
B3gntl1 A T 11: 121,563,851 (GRCm39) V3D probably benign Het
Baiap2l1 T C 5: 144,212,701 (GRCm39) Y438C probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Ccdc110 T A 8: 46,388,194 (GRCm39) N50K probably benign Het
Ccdc168 T A 1: 44,100,257 (GRCm39) K280N possibly damaging Het
Cep76 A T 18: 67,767,850 (GRCm39) N227K probably benign Het
Col6a4 A T 9: 105,957,746 (GRCm39) V26D probably damaging Het
Cpe T A 8: 65,064,501 (GRCm39) I233F probably damaging Het
Cpsf2 T C 12: 101,955,045 (GRCm39) V272A probably damaging Het
Defa34 A G 8: 22,155,988 (GRCm39) probably null Het
Dnah12 A G 14: 26,520,856 (GRCm39) R1892G probably damaging Het
Efr3b G T 12: 4,032,058 (GRCm39) D183E probably benign Het
Epyc A G 10: 97,485,625 (GRCm39) T22A probably benign Het
Fam83a C A 15: 57,873,322 (GRCm39) Q384K probably benign Het
Fam83b G T 9: 76,400,108 (GRCm39) L332I possibly damaging Het
Ggn C T 7: 28,870,721 (GRCm39) P47S probably damaging Het
Gli3 T G 13: 15,899,370 (GRCm39) L919R probably damaging Het
Golgb1 A G 16: 36,751,997 (GRCm39) I3144V probably benign Het
Gpr108 T C 17: 57,542,358 (GRCm39) D549G possibly damaging Het
Gpr39 C T 1: 125,605,237 (GRCm39) T55M probably damaging Het
Grk4 A G 5: 34,873,557 (GRCm39) T208A probably damaging Het
Gucy2e T C 11: 69,126,402 (GRCm39) D326G probably benign Het
H2-Eb2 C T 17: 34,553,218 (GRCm39) Q135* probably null Het
Hectd4 T A 5: 121,419,959 (GRCm39) Y635N possibly damaging Het
Hectd4 G A 5: 121,443,736 (GRCm39) E1319K possibly damaging Het
Hnrnph3 T A 10: 62,853,994 (GRCm39) R41S probably benign Het
Hnrnph3 T A 10: 62,855,279 (GRCm39) D2V probably damaging Het
Hs3st2 T C 7: 121,099,792 (GRCm39) S213P probably damaging Het
Ikbkb A T 8: 23,161,651 (GRCm39) C412* probably null Het
Kctd21 T C 7: 96,996,748 (GRCm39) F74L probably damaging Het
Krt23 T A 11: 99,377,608 (GRCm39) I133L probably damaging Het
Krt74 T C 15: 101,671,751 (GRCm39) noncoding transcript Het
Lmtk3 T A 7: 45,443,536 (GRCm39) L740M possibly damaging Het
Lrrc10 T A 10: 116,881,695 (GRCm39) L123Q probably damaging Het
Map1a A T 2: 121,136,255 (GRCm39) H2357L probably benign Het
Mcf2l A G 8: 13,047,337 (GRCm39) D233G probably damaging Het
Mdn1 A G 4: 32,738,619 (GRCm39) N3524S probably benign Het
Msto1 A G 3: 88,818,848 (GRCm39) L269P probably benign Het
Naca C T 10: 127,880,659 (GRCm39) A1897V probably benign Het
Or1j10 A T 2: 36,267,474 (GRCm39) I229F probably benign Het
Or4a39 A T 2: 89,237,135 (GRCm39) M96K probably damaging Het
Or5w15 A G 2: 87,567,825 (GRCm39) V281A probably damaging Het
Or8b12i T C 9: 20,082,561 (GRCm39) Y102C probably benign Het
Pdzrn3 A T 6: 101,128,014 (GRCm39) I884N probably damaging Het
Phf24 G T 4: 42,933,761 (GRCm39) V48L possibly damaging Het
Pkn1 C A 8: 84,398,953 (GRCm39) C678F probably damaging Het
Pla2g4a T A 1: 149,716,398 (GRCm39) M688L possibly damaging Het
Ppp1r3c A T 19: 36,711,617 (GRCm39) F51Y possibly damaging Het
Psen2 T C 1: 180,066,479 (GRCm39) T153A probably damaging Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rbp3 A G 14: 33,684,376 (GRCm39) K1135R possibly damaging Het
Slco2b1 T A 7: 99,310,743 (GRCm39) M603L probably benign Het
Sncaip A G 18: 53,001,781 (GRCm39) T101A probably benign Het
Ssh1 A T 5: 114,084,766 (GRCm39) D448E probably benign Het
Ssmem1 A T 6: 30,519,547 (GRCm39) probably null Het
Stk11 T C 10: 79,961,920 (GRCm39) V47A probably damaging Het
Sv2b T G 7: 74,786,140 (GRCm39) M427L probably benign Het
Syne1 A G 10: 5,317,600 (GRCm39) L498P probably damaging Het
Syne2 T C 12: 75,900,923 (GRCm39) probably null Het
Taf6l G T 19: 8,755,885 (GRCm39) H254Q probably benign Het
Tas2r123 T C 6: 132,824,295 (GRCm39) V64A probably benign Het
Tm9sf1 A T 14: 55,878,886 (GRCm39) F169I possibly damaging Het
Tmpo A C 10: 90,998,958 (GRCm39) I276M probably benign Het
Tnnc1 A G 14: 30,933,365 (GRCm39) D149G probably damaging Het
Tpr AAGAGAGAGAGAGAG AAGAGAGAGAGAG 1: 150,299,418 (GRCm39) probably null Het
Traf3ip3 T A 1: 192,860,539 (GRCm39) probably null Het
Trim55 G T 3: 19,725,256 (GRCm39) V258L possibly damaging Het
Trpm1 G A 7: 63,873,506 (GRCm39) G587D probably damaging Het
Ttn A G 2: 76,560,756 (GRCm39) V29215A probably damaging Het
Ube2u A G 4: 100,343,870 (GRCm39) I90V probably benign Het
Upb1 T C 10: 75,250,917 (GRCm39) probably null Het
Vmn2r57 A T 7: 41,077,216 (GRCm39) S317T possibly damaging Het
Wdr73 G A 7: 80,547,698 (GRCm39) Q107* probably null Het
Zfp628 A T 7: 4,922,732 (GRCm39) Q318L probably benign Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 8,984,587 (GRCm39) missense probably damaging 0.99
IGL00509:Ahnak APN 19 8,987,315 (GRCm39) missense possibly damaging 0.94
IGL00539:Ahnak APN 19 8,985,272 (GRCm39) missense possibly damaging 0.50
IGL00558:Ahnak APN 19 8,981,671 (GRCm39) missense possibly damaging 0.93
IGL00567:Ahnak APN 19 8,990,747 (GRCm39) missense probably benign 0.24
IGL00706:Ahnak APN 19 8,991,094 (GRCm39) nonsense probably null
IGL00807:Ahnak APN 19 8,985,886 (GRCm39) missense possibly damaging 0.92
IGL00870:Ahnak APN 19 8,991,062 (GRCm39) missense probably damaging 1.00
IGL01101:Ahnak APN 19 8,990,251 (GRCm39) intron probably benign
IGL01118:Ahnak APN 19 8,989,942 (GRCm39) missense probably damaging 1.00
IGL01288:Ahnak APN 19 8,979,858 (GRCm39) missense possibly damaging 0.94
IGL01324:Ahnak APN 19 8,980,396 (GRCm39) missense probably damaging 1.00
IGL01341:Ahnak APN 19 8,989,067 (GRCm39) missense probably benign
IGL01541:Ahnak APN 19 8,985,243 (GRCm39) missense possibly damaging 0.95
IGL01580:Ahnak APN 19 8,980,203 (GRCm39) missense probably benign 0.02
IGL01595:Ahnak APN 19 8,980,865 (GRCm39) nonsense probably null
IGL01746:Ahnak APN 19 8,982,276 (GRCm39) missense possibly damaging 0.89
IGL01766:Ahnak APN 19 8,977,482 (GRCm39) missense unknown
IGL01821:Ahnak APN 19 8,989,482 (GRCm39) missense probably benign
IGL01913:Ahnak APN 19 8,983,428 (GRCm39) nonsense probably null
IGL01934:Ahnak APN 19 8,980,021 (GRCm39) missense probably damaging 1.00
IGL01940:Ahnak APN 19 8,983,921 (GRCm39) missense probably benign 0.14
IGL01958:Ahnak APN 19 8,992,273 (GRCm39) missense possibly damaging 0.59
IGL02145:Ahnak APN 19 8,980,219 (GRCm39) missense probably benign 0.11
IGL02246:Ahnak APN 19 8,985,632 (GRCm39) missense probably damaging 1.00
IGL02282:Ahnak APN 19 8,983,351 (GRCm39) missense probably damaging 1.00
IGL02428:Ahnak APN 19 8,992,197 (GRCm39) missense possibly damaging 0.83
IGL02442:Ahnak APN 19 8,981,380 (GRCm39) missense probably damaging 1.00
IGL02474:Ahnak APN 19 8,982,297 (GRCm39) missense probably benign 0.13
IGL02483:Ahnak APN 19 8,980,672 (GRCm39) missense probably benign 0.01
IGL02616:Ahnak APN 19 8,982,991 (GRCm39) missense probably benign 0.03
IGL02630:Ahnak APN 19 8,989,441 (GRCm39) missense probably damaging 1.00
IGL02690:Ahnak APN 19 8,989,948 (GRCm39) nonsense probably null
IGL02717:Ahnak APN 19 8,979,751 (GRCm39) missense probably benign 0.00
IGL02721:Ahnak APN 19 8,987,071 (GRCm39) missense probably benign 0.07
IGL02737:Ahnak APN 19 8,981,957 (GRCm39) missense probably benign 0.17
IGL02850:Ahnak APN 19 8,979,960 (GRCm39) missense probably benign 0.00
IGL03071:Ahnak APN 19 8,989,282 (GRCm39) missense possibly damaging 0.63
IGL03072:Ahnak APN 19 8,983,872 (GRCm39) missense probably benign 0.11
IGL03094:Ahnak APN 19 8,980,911 (GRCm39) missense possibly damaging 0.64
IGL03140:Ahnak APN 19 8,982,576 (GRCm39) intron probably benign
IGL03176:Ahnak APN 19 8,979,813 (GRCm39) missense probably damaging 1.00
IGL03176:Ahnak APN 19 8,985,530 (GRCm39) missense possibly damaging 0.56
IGL03189:Ahnak APN 19 8,988,603 (GRCm39) missense possibly damaging 0.65
IGL03357:Ahnak APN 19 8,986,689 (GRCm39) intron probably benign
IGL03371:Ahnak APN 19 8,981,592 (GRCm39) missense possibly damaging 0.91
Eskimo UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
Nanook UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
Netsilik UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
IGL03097:Ahnak UTSW 19 8,979,751 (GRCm39) missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 8,983,540 (GRCm39) missense possibly damaging 0.87
R0054:Ahnak UTSW 19 8,989,420 (GRCm39) missense probably damaging 1.00
R0094:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R0110:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0141:Ahnak UTSW 19 8,984,044 (GRCm39) missense probably damaging 1.00
R0166:Ahnak UTSW 19 8,983,089 (GRCm39) missense probably damaging 1.00
R0309:Ahnak UTSW 19 8,979,859 (GRCm39) missense probably damaging 1.00
R0368:Ahnak UTSW 19 8,985,714 (GRCm39) nonsense probably null
R0386:Ahnak UTSW 19 8,988,508 (GRCm39) missense possibly damaging 0.94
R0401:Ahnak UTSW 19 8,992,480 (GRCm39) missense probably benign 0.24
R0415:Ahnak UTSW 19 8,990,235 (GRCm39) intron probably benign
R0463:Ahnak UTSW 19 8,986,771 (GRCm39) intron probably benign
R0470:Ahnak UTSW 19 8,986,331 (GRCm39) missense probably benign 0.29
R0487:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R0487:Ahnak UTSW 19 8,984,515 (GRCm39) missense probably benign 0.00
R0499:Ahnak UTSW 19 8,977,628 (GRCm39) splice site probably benign
R0506:Ahnak UTSW 19 8,986,492 (GRCm39) missense probably damaging 1.00
R0510:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0557:Ahnak UTSW 19 8,979,308 (GRCm39) missense probably benign 0.10
R0570:Ahnak UTSW 19 8,991,062 (GRCm39) missense probably damaging 1.00
R0610:Ahnak UTSW 19 8,985,242 (GRCm39) missense probably benign 0.08
R0646:Ahnak UTSW 19 8,990,766 (GRCm39) nonsense probably null
R0659:Ahnak UTSW 19 8,992,366 (GRCm39) missense possibly damaging 0.60
R0791:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0792:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0840:Ahnak UTSW 19 8,982,427 (GRCm39) missense probably damaging 1.00
R0847:Ahnak UTSW 19 8,983,797 (GRCm39) nonsense probably null
R0941:Ahnak UTSW 19 8,987,278 (GRCm39) missense probably damaging 1.00
R0962:Ahnak UTSW 19 8,990,212 (GRCm39) intron probably benign
R1017:Ahnak UTSW 19 8,987,907 (GRCm39) missense probably damaging 0.99
R1037:Ahnak UTSW 19 8,984,982 (GRCm39) missense probably benign 0.27
R1085:Ahnak UTSW 19 8,990,489 (GRCm39) missense possibly damaging 0.50
R1113:Ahnak UTSW 19 8,982,984 (GRCm39) missense probably benign 0.29
R1140:Ahnak UTSW 19 8,981,609 (GRCm39) missense probably damaging 1.00
R1158:Ahnak UTSW 19 8,991,290 (GRCm39) missense probably benign 0.00
R1218:Ahnak UTSW 19 8,992,983 (GRCm39) missense probably damaging 1.00
R1225:Ahnak UTSW 19 8,980,247 (GRCm39) missense probably damaging 1.00
R1245:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R1421:Ahnak UTSW 19 8,992,995 (GRCm39) missense possibly damaging 0.95
R1447:Ahnak UTSW 19 8,984,446 (GRCm39) missense probably damaging 0.98
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1471:Ahnak UTSW 19 8,990,296 (GRCm39) intron probably benign
R1507:Ahnak UTSW 19 8,987,441 (GRCm39) missense probably damaging 1.00
R1521:Ahnak UTSW 19 8,982,092 (GRCm39) missense probably benign 0.11
R1568:Ahnak UTSW 19 8,979,739 (GRCm39) missense probably damaging 0.98
R1569:Ahnak UTSW 19 8,981,458 (GRCm39) missense possibly damaging 0.78
R1616:Ahnak UTSW 19 8,986,351 (GRCm39) missense possibly damaging 0.94
R1638:Ahnak UTSW 19 8,986,813 (GRCm39) missense probably benign 0.01
R1680:Ahnak UTSW 19 8,987,327 (GRCm39) missense probably benign 0.05
R1713:Ahnak UTSW 19 8,989,173 (GRCm39) missense possibly damaging 0.95
R1722:Ahnak UTSW 19 8,988,019 (GRCm39) missense probably damaging 0.99
R1771:Ahnak UTSW 19 8,991,117 (GRCm39) missense probably benign 0.24
R1795:Ahnak UTSW 19 8,979,802 (GRCm39) missense possibly damaging 0.79
R1823:Ahnak UTSW 19 8,982,269 (GRCm39) missense probably damaging 0.99
R1842:Ahnak UTSW 19 8,983,231 (GRCm39) missense probably damaging 0.99
R1854:Ahnak UTSW 19 8,991,196 (GRCm39) missense possibly damaging 0.61
R1856:Ahnak UTSW 19 8,979,412 (GRCm39) missense possibly damaging 0.86
R1886:Ahnak UTSW 19 8,993,343 (GRCm39) missense probably damaging 0.98
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1912:Ahnak UTSW 19 8,995,245 (GRCm39) missense probably damaging 1.00
R1913:Ahnak UTSW 19 8,985,286 (GRCm39) missense probably damaging 0.99
R1942:Ahnak UTSW 19 8,992,447 (GRCm39) missense probably damaging 0.98
R1987:Ahnak UTSW 19 8,992,615 (GRCm39) missense probably damaging 1.00
R2006:Ahnak UTSW 19 8,984,439 (GRCm39) missense probably damaging 1.00
R2013:Ahnak UTSW 19 8,991,937 (GRCm39) missense probably damaging 0.98
R2014:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R2047:Ahnak UTSW 19 8,991,664 (GRCm39) missense possibly damaging 0.67
R2048:Ahnak UTSW 19 8,984,420 (GRCm39) missense probably damaging 0.99
R2060:Ahnak UTSW 19 8,985,405 (GRCm39) missense probably benign 0.08
R2083:Ahnak UTSW 19 8,988,921 (GRCm39) missense probably damaging 1.00
R2157:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R2167:Ahnak UTSW 19 8,988,858 (GRCm39) nonsense probably null
R2208:Ahnak UTSW 19 8,995,096 (GRCm39) missense probably benign 0.00
R2224:Ahnak UTSW 19 8,990,355 (GRCm39) intron probably benign
R2268:Ahnak UTSW 19 8,987,938 (GRCm39) missense possibly damaging 0.66
R2420:Ahnak UTSW 19 8,986,620 (GRCm39) missense possibly damaging 0.89
R2426:Ahnak UTSW 19 8,980,215 (GRCm39) missense possibly damaging 0.81
R2910:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2911:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2981:Ahnak UTSW 19 8,977,512 (GRCm39) missense probably damaging 0.97
R3151:Ahnak UTSW 19 8,987,308 (GRCm39) missense probably benign 0.12
R3155:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R3422:Ahnak UTSW 19 8,984,116 (GRCm39) missense probably benign 0.05
R3422:Ahnak UTSW 19 8,983,072 (GRCm39) missense probably benign 0.39
R3430:Ahnak UTSW 19 8,984,322 (GRCm39) missense probably benign 0.42
R3433:Ahnak UTSW 19 8,987,358 (GRCm39) missense probably benign 0.01
R3711:Ahnak UTSW 19 8,985,262 (GRCm39) missense probably benign
R3723:Ahnak UTSW 19 8,994,217 (GRCm39) missense possibly damaging 0.79
R3775:Ahnak UTSW 19 8,986,387 (GRCm39) missense possibly damaging 0.91
R3858:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3859:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3922:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3924:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3926:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R4026:Ahnak UTSW 19 8,988,663 (GRCm39) missense probably damaging 0.97
R4051:Ahnak UTSW 19 8,991,691 (GRCm39) missense probably damaging 1.00
R4209:Ahnak UTSW 19 8,979,964 (GRCm39) missense probably damaging 1.00
R4234:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R4237:Ahnak UTSW 19 8,979,147 (GRCm39) missense probably benign 0.02
R4285:Ahnak UTSW 19 8,994,203 (GRCm39) nonsense probably null
R4331:Ahnak UTSW 19 8,993,184 (GRCm39) missense probably damaging 1.00
R4342:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R4430:Ahnak UTSW 19 8,980,404 (GRCm39) missense probably benign 0.00
R4554:Ahnak UTSW 19 8,992,294 (GRCm39) missense probably damaging 1.00
R4602:Ahnak UTSW 19 8,988,189 (GRCm39) missense possibly damaging 0.66
R4612:Ahnak UTSW 19 8,981,088 (GRCm39) missense probably benign 0.44
R4655:Ahnak UTSW 19 8,986,065 (GRCm39) missense probably damaging 1.00
R4656:Ahnak UTSW 19 8,982,219 (GRCm39) missense possibly damaging 0.80
R4700:Ahnak UTSW 19 8,982,045 (GRCm39) missense probably benign 0.02
R4704:Ahnak UTSW 19 8,989,622 (GRCm39) intron probably benign
R4704:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R4705:Ahnak UTSW 19 8,994,270 (GRCm39) missense probably benign 0.07
R4707:Ahnak UTSW 19 8,994,099 (GRCm39) missense probably benign 0.03
R4732:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4733:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4778:Ahnak UTSW 19 8,989,339 (GRCm39) missense possibly damaging 0.79
R4782:Ahnak UTSW 19 8,989,863 (GRCm39) intron probably benign
R4832:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R4882:Ahnak UTSW 19 8,983,261 (GRCm39) missense probably damaging 0.98
R4884:Ahnak UTSW 19 8,990,118 (GRCm39) intron probably benign
R4895:Ahnak UTSW 19 8,994,805 (GRCm39) missense probably benign 0.43
R4930:Ahnak UTSW 19 8,988,331 (GRCm39) missense possibly damaging 0.79
R4951:Ahnak UTSW 19 8,995,199 (GRCm39) missense probably damaging 1.00
R4968:Ahnak UTSW 19 8,992,464 (GRCm39) missense probably damaging 1.00
R5026:Ahnak UTSW 19 8,987,995 (GRCm39) missense possibly damaging 0.46
R5050:Ahnak UTSW 19 8,989,822 (GRCm39) intron probably benign
R5073:Ahnak UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
R5110:Ahnak UTSW 19 8,992,123 (GRCm39) missense probably damaging 1.00
R5119:Ahnak UTSW 19 8,991,008 (GRCm39) missense probably benign 0.00
R5128:Ahnak UTSW 19 8,994,451 (GRCm39) missense probably damaging 1.00
R5139:Ahnak UTSW 19 8,982,019 (GRCm39) missense probably damaging 1.00
R5150:Ahnak UTSW 19 8,988,268 (GRCm39) missense possibly damaging 0.46
R5151:Ahnak UTSW 19 8,994,933 (GRCm39) missense probably benign 0.03
R5165:Ahnak UTSW 19 8,993,029 (GRCm39) missense possibly damaging 0.95
R5236:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R5361:Ahnak UTSW 19 8,992,705 (GRCm39) missense possibly damaging 0.92
R5366:Ahnak UTSW 19 8,994,099 (GRCm39) missense possibly damaging 0.65
R5387:Ahnak UTSW 19 8,981,055 (GRCm39) missense probably damaging 1.00
R5396:Ahnak UTSW 19 8,984,539 (GRCm39) missense probably damaging 0.99
R5583:Ahnak UTSW 19 8,984,281 (GRCm39) missense probably damaging 0.99
R5587:Ahnak UTSW 19 8,986,840 (GRCm39) missense possibly damaging 0.88
R5620:Ahnak UTSW 19 8,990,458 (GRCm39) nonsense probably null
R5643:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5644:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5657:Ahnak UTSW 19 8,991,979 (GRCm39) missense probably damaging 0.99
R5688:Ahnak UTSW 19 8,979,883 (GRCm39) missense probably benign 0.01
R5702:Ahnak UTSW 19 8,979,204 (GRCm39) missense probably damaging 1.00
R5727:Ahnak UTSW 19 8,994,111 (GRCm39) missense probably damaging 0.99
R5730:Ahnak UTSW 19 8,987,617 (GRCm39) missense possibly damaging 0.81
R5755:Ahnak UTSW 19 8,979,096 (GRCm39) missense probably benign 0.06
R5760:Ahnak UTSW 19 8,990,926 (GRCm39) missense probably damaging 1.00
R5789:Ahnak UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
R5790:Ahnak UTSW 19 8,992,612 (GRCm39) missense probably damaging 0.99
R5795:Ahnak UTSW 19 8,989,746 (GRCm39) nonsense probably null
R5808:Ahnak UTSW 19 8,987,599 (GRCm39) missense possibly damaging 0.91
R5867:Ahnak UTSW 19 8,987,416 (GRCm39) missense probably damaging 0.99
R5878:Ahnak UTSW 19 8,985,706 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,995,575 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,991,131 (GRCm39) missense possibly damaging 0.63
R5912:Ahnak UTSW 19 8,989,267 (GRCm39) missense probably damaging 0.99
R5935:Ahnak UTSW 19 8,992,546 (GRCm39) missense possibly damaging 0.91
R5969:Ahnak UTSW 19 8,993,949 (GRCm39) missense probably damaging 1.00
R5988:Ahnak UTSW 19 8,986,711 (GRCm39) intron probably benign
R6000:Ahnak UTSW 19 8,990,475 (GRCm39) nonsense probably null
R6005:Ahnak UTSW 19 8,992,525 (GRCm39) missense possibly damaging 0.61
R6101:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6105:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6116:Ahnak UTSW 19 8,990,327 (GRCm39) intron probably benign
R6209:Ahnak UTSW 19 8,989,930 (GRCm39) missense probably damaging 1.00
R6240:Ahnak UTSW 19 8,990,947 (GRCm39) missense probably damaging 1.00
R6255:Ahnak UTSW 19 8,985,389 (GRCm39) missense possibly damaging 0.95
R6263:Ahnak UTSW 19 8,995,641 (GRCm39) missense probably benign 0.03
R6287:Ahnak UTSW 19 8,992,367 (GRCm39) missense probably benign 0.02
R6296:Ahnak UTSW 19 8,980,669 (GRCm39) missense probably damaging 0.99
R6315:Ahnak UTSW 19 8,983,990 (GRCm39) missense probably damaging 0.99
R6328:Ahnak UTSW 19 8,984,512 (GRCm39) missense probably benign 0.11
R6331:Ahnak UTSW 19 8,983,989 (GRCm39) missense probably benign 0.18
R6355:Ahnak UTSW 19 8,986,126 (GRCm39) missense probably benign 0.02
R6409:Ahnak UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
R6567:Ahnak UTSW 19 8,986,170 (GRCm39) missense probably benign 0.27
R6572:Ahnak UTSW 19 8,985,340 (GRCm39) missense probably damaging 0.99
R6574:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R6590:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6620:Ahnak UTSW 19 8,992,674 (GRCm39) missense possibly damaging 0.95
R6690:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6731:Ahnak UTSW 19 8,988,926 (GRCm39) missense possibly damaging 0.85
R6756:Ahnak UTSW 19 8,984,925 (GRCm39) missense possibly damaging 0.59
R6846:Ahnak UTSW 19 8,989,221 (GRCm39) missense possibly damaging 0.66
R6854:Ahnak UTSW 19 8,992,599 (GRCm39) missense probably damaging 1.00
R6857:Ahnak UTSW 19 9,014,532 (GRCm39) nonsense probably null
R6863:Ahnak UTSW 19 8,989,729 (GRCm39) intron probably benign
R6876:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R6958:Ahnak UTSW 19 8,992,579 (GRCm39) missense possibly damaging 0.88
R7126:Ahnak UTSW 19 8,979,723 (GRCm39) missense possibly damaging 0.61
R7181:Ahnak UTSW 19 8,990,852 (GRCm39) missense probably damaging 1.00
R7183:Ahnak UTSW 19 8,995,032 (GRCm39) missense probably damaging 1.00
R7202:Ahnak UTSW 19 8,995,163 (GRCm39) missense probably damaging 1.00
R7235:Ahnak UTSW 19 8,989,852 (GRCm39) missense unknown
R7241:Ahnak UTSW 19 8,986,395 (GRCm39) missense possibly damaging 0.65
R7269:Ahnak UTSW 19 8,983,981 (GRCm39) missense probably damaging 1.00
R7311:Ahnak UTSW 19 8,979,507 (GRCm39) missense probably benign 0.04
R7311:Ahnak UTSW 19 8,987,191 (GRCm39) missense possibly damaging 0.56
R7329:Ahnak UTSW 19 8,979,156 (GRCm39) missense probably damaging 0.99
R7339:Ahnak UTSW 19 8,985,529 (GRCm39) missense possibly damaging 0.75
R7390:Ahnak UTSW 19 8,980,569 (GRCm39) missense probably benign 0.02
R7400:Ahnak UTSW 19 8,991,977 (GRCm39) missense probably damaging 0.99
R7444:Ahnak UTSW 19 8,984,787 (GRCm39) missense probably benign 0.08
R7483:Ahnak UTSW 19 8,982,186 (GRCm39) missense probably damaging 1.00
R7498:Ahnak UTSW 19 8,989,383 (GRCm39) missense probably benign 0.14
R7521:Ahnak UTSW 19 8,979,715 (GRCm39) missense possibly damaging 0.89
R7522:Ahnak UTSW 19 8,979,686 (GRCm39) missense probably benign 0.01
R7552:Ahnak UTSW 19 8,984,188 (GRCm39) missense probably benign 0.18
R7563:Ahnak UTSW 19 8,988,529 (GRCm39) missense probably damaging 0.99
R7565:Ahnak UTSW 19 8,993,520 (GRCm39) missense probably benign 0.05
R7571:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R7583:Ahnak UTSW 19 8,983,457 (GRCm39) missense possibly damaging 0.90
R7600:Ahnak UTSW 19 8,981,938 (GRCm39) missense possibly damaging 0.89
R7771:Ahnak UTSW 19 8,992,411 (GRCm39) missense probably damaging 0.99
R7787:Ahnak UTSW 19 8,986,679 (GRCm39) missense unknown
R7827:Ahnak UTSW 19 8,982,708 (GRCm39) nonsense probably null
R7857:Ahnak UTSW 19 8,984,832 (GRCm39) missense probably damaging 0.97
R7916:Ahnak UTSW 19 8,983,196 (GRCm39) missense possibly damaging 0.66
R7939:Ahnak UTSW 19 8,991,448 (GRCm39) nonsense probably null
R7959:Ahnak UTSW 19 8,988,013 (GRCm39) missense possibly damaging 0.46
R7962:Ahnak UTSW 19 8,990,164 (GRCm39) missense unknown
R7979:Ahnak UTSW 19 8,988,796 (GRCm39) missense probably damaging 1.00
R8006:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R8013:Ahnak UTSW 19 8,986,699 (GRCm39) missense unknown
R8033:Ahnak UTSW 19 8,981,074 (GRCm39) missense probably benign 0.10
R8124:Ahnak UTSW 19 8,984,487 (GRCm39) missense probably damaging 0.99
R8125:Ahnak UTSW 19 8,989,240 (GRCm39) missense possibly damaging 0.95
R8129:Ahnak UTSW 19 8,977,464 (GRCm39) start codon destroyed not run
R8151:Ahnak UTSW 19 8,982,043 (GRCm39) missense possibly damaging 0.59
R8190:Ahnak UTSW 19 8,979,619 (GRCm39) missense probably benign 0.01
R8221:Ahnak UTSW 19 8,987,800 (GRCm39) nonsense probably null
R8241:Ahnak UTSW 19 8,984,659 (GRCm39) missense probably benign 0.15
R8244:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8248:Ahnak UTSW 19 8,979,310 (GRCm39) missense probably damaging 1.00
R8261:Ahnak UTSW 19 8,982,817 (GRCm39) missense probably damaging 1.00
R8330:Ahnak UTSW 19 8,987,026 (GRCm39) missense possibly damaging 0.86
R8380:Ahnak UTSW 19 8,995,219 (GRCm39) missense probably benign 0.05
R8407:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8409:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8463:Ahnak UTSW 19 8,986,113 (GRCm39) missense probably benign 0.07
R8511:Ahnak UTSW 19 8,989,719 (GRCm39) missense unknown
R8528:Ahnak UTSW 19 8,985,092 (GRCm39) missense probably damaging 1.00
R8549:Ahnak UTSW 19 8,988,847 (GRCm39) missense probably damaging 1.00
R8674:Ahnak UTSW 19 8,983,360 (GRCm39) missense probably damaging 0.98
R8716:Ahnak UTSW 19 8,986,438 (GRCm39) missense probably damaging 1.00
R8722:Ahnak UTSW 19 8,990,710 (GRCm39) nonsense probably null
R8751:Ahnak UTSW 19 8,987,509 (GRCm39) missense probably damaging 1.00
R8752:Ahnak UTSW 19 8,992,901 (GRCm39) missense probably damaging 1.00
R8783:Ahnak UTSW 19 8,988,837 (GRCm39) missense probably damaging 1.00
R8844:Ahnak UTSW 19 8,984,254 (GRCm39) missense probably damaging 1.00
R8859:Ahnak UTSW 19 8,984,567 (GRCm39) missense probably damaging 1.00
R8882:Ahnak UTSW 19 8,978,106 (GRCm39) missense probably damaging 1.00
R8907:Ahnak UTSW 19 8,986,452 (GRCm39) missense probably benign 0.24
R8938:Ahnak UTSW 19 8,989,099 (GRCm39) missense probably benign 0.00
R8975:Ahnak UTSW 19 8,990,101 (GRCm39) missense probably damaging 1.00
R8983:Ahnak UTSW 19 8,981,477 (GRCm39) missense possibly damaging 0.75
R9017:Ahnak UTSW 19 8,987,487 (GRCm39) missense probably damaging 1.00
R9027:Ahnak UTSW 19 8,984,617 (GRCm39) missense possibly damaging 0.94
R9081:Ahnak UTSW 19 8,985,890 (GRCm39) missense possibly damaging 0.81
R9104:Ahnak UTSW 19 8,987,711 (GRCm39) missense probably benign 0.01
R9112:Ahnak UTSW 19 8,987,149 (GRCm39) missense probably damaging 0.98
R9145:Ahnak UTSW 19 8,992,287 (GRCm39) missense probably benign 0.38
R9189:Ahnak UTSW 19 8,988,247 (GRCm39) missense possibly damaging 0.92
R9221:Ahnak UTSW 19 8,989,943 (GRCm39) missense probably damaging 1.00
R9261:Ahnak UTSW 19 8,993,503 (GRCm39) missense possibly damaging 0.63
R9299:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9325:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R9337:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9340:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R9351:Ahnak UTSW 19 8,985,232 (GRCm39) missense probably damaging 1.00
R9416:Ahnak UTSW 19 8,990,266 (GRCm39) missense unknown
R9462:Ahnak UTSW 19 8,981,299 (GRCm39) missense probably damaging 0.96
R9469:Ahnak UTSW 19 8,988,225 (GRCm39) missense probably damaging 1.00
R9485:Ahnak UTSW 19 8,979,438 (GRCm39) missense probably benign 0.16
R9503:Ahnak UTSW 19 8,987,458 (GRCm39) missense probably damaging 1.00
R9524:Ahnak UTSW 19 9,014,617 (GRCm39) missense
R9534:Ahnak UTSW 19 8,980,976 (GRCm39) missense probably benign 0.20
R9598:Ahnak UTSW 19 8,981,149 (GRCm39) missense probably benign 0.42
R9611:Ahnak UTSW 19 8,989,162 (GRCm39) missense probably damaging 0.99
R9624:Ahnak UTSW 19 8,989,846 (GRCm39) missense unknown
R9649:Ahnak UTSW 19 8,985,786 (GRCm39) nonsense probably null
R9683:Ahnak UTSW 19 8,984,719 (GRCm39) missense possibly damaging 0.94
R9691:Ahnak UTSW 19 8,989,090 (GRCm39) missense possibly damaging 0.49
R9712:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9712:Ahnak UTSW 19 8,984,392 (GRCm39) small deletion probably benign
R9713:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9715:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9725:Ahnak UTSW 19 8,991,607 (GRCm39) missense probably damaging 1.00
R9725:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R9747:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R9798:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
RF007:Ahnak UTSW 19 8,990,965 (GRCm39) missense possibly damaging 0.45
X0021:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
X0027:Ahnak UTSW 19 8,989,401 (GRCm39) missense probably damaging 1.00
Z1088:Ahnak UTSW 19 8,993,446 (GRCm39) missense probably damaging 0.99
Z1176:Ahnak UTSW 19 8,986,220 (GRCm39) missense probably damaging 0.97
Z1177:Ahnak UTSW 19 8,994,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCTCCAACTCCTTCAGTGATG -3'
(R):5'- AGCCTACAGGCACTTGGTTTGTCG -3'

Sequencing Primer
(F):5'- CACCCCAACTGGGACTTTG -3'
(R):5'- TCGGCACTTGCCACTGG -3'
Posted On 2013-05-23