Mutagenetix > Incidental Mutations

Incidental Mutation 'R5525:Olfr1102'

431800

Institutional Source

Beutler Lab

Gene Symbol

Olfr1102

Ensembl Gene

ENSMUSG00000049843

Gene Name

olfactory receptor 1102

Synonyms

MOR179-4, GA_x6K02T2Q125-48487992-48488966

MMRRC Submission

043083-MU

Accession Numbers

Ncbi RefSeq: NM_207154.2; MGI: 3030936

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R5525 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86998398-87003618 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87002339 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 123 (E123D)

Ref Sequence

ENSEMBL: ENSMUSP00000149634 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055129] [ENSMUST00000214002]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055129
AA Change: E123D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000052861
Gene: ENSMUSG00000049843
AA Change: E123D

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
Pfam:7tm_4	43	320	8.1e-52	PFAM
Pfam:7TM_GPCR_Srsx	47	322	8.7e-6	PFAM
Pfam:7tm_1	53	302	3.6e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214002
AA Change: E123D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,099,983	T1501A	probably benign	Het
Acin1	G	A	14: 54,664,391	A648V	possibly damaging	Het
Agap1	A	G	1: 89,743,773	T401A	possibly damaging	Het
Anapc4	T	G	5: 52,856,809	M440R	probably damaging	Het
Ankrd26	A	G	6: 118,527,731	M739T	probably benign	Het
Brip1	T	C	11: 86,110,447	E721G	possibly damaging	Het
Bzw1	A	G	1: 58,402,906	E221G	possibly damaging	Het
Cenpm	A	C	15: 82,239,291		probably null	Het
Exosc1	T	A	19: 41,924,018	K143N	probably damaging	Het
Fgd5	T	A	6: 92,066,247	L1236Q	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Grm3	C	T	5: 9,504,872	V807I	probably damaging	Het
Kndc1	A	G	7: 139,924,111	N1110S	probably benign	Het
Magi1	A	T	6: 93,792,373	V17D	possibly damaging	Het
Mdn1	T	G	4: 32,767,961	M5298R	possibly damaging	Het
Nlrp9c	T	A	7: 26,384,501	E551V	probably damaging	Het
Oacyl	A	C	18: 65,745,356	I457L	probably benign	Het
Olfr103	C	T	17: 37,336,626	G202D	probably damaging	Het
Olfr494	A	G	7: 108,367,999	I170V	probably benign	Het
Rab11fip3	T	C	17: 25,991,295	E996G	probably damaging	Het
Rabep1	T	A	11: 70,923,146	S554T	probably damaging	Het
Rln1	T	C	19: 29,334,520	E26G	probably benign	Het
Rpf1	A	G	3: 146,517,804		silent	Het
Sdk1	T	C	5: 142,185,265	V1961A	possibly damaging	Het
Serpinb8	A	T	1: 107,607,293	I365F	probably damaging	Het
Shank2	A	G	7: 144,070,109	D277G	probably damaging	Het
Snapc4	ACTGCTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGC	2: 26,369,526		probably benign	Het
Thsd7a	T	C	6: 12,332,007	T1269A	possibly damaging	Het
Ttll3	A	G	6: 113,412,978	N776D	probably benign	Het
Unc80	A	G	1: 66,606,614	E1483G	possibly damaging	Het
Ush2a	A	G	1: 188,753,606	D2971G	probably benign	Het
Zfp322a	A	G	13: 23,357,515	V19A	probably benign	Het
Zfp462	C	A	4: 55,050,281	P2164T	possibly damaging	Het

Other mutations in Olfr1102

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01371:Olfr1102	APN	2	87002923	missense	probably benign	0.31
IGL01584:Olfr1102	APN	2	87002151	missense	probably benign	0.04
IGL01913:Olfr1102	APN	2	87002820	missense	possibly damaging	0.68
IGL02672:Olfr1102	APN	2	87002073	missense	probably benign	0.00
R0003:Olfr1102	UTSW	2	87002366	nonsense	probably null
R0003:Olfr1102	UTSW	2	87002366	nonsense	probably null
R1674:Olfr1102	UTSW	2	87002233	missense	probably benign	0.07
R1688:Olfr1102	UTSW	2	87002386	missense	probably benign	0.01
R3826:Olfr1102	UTSW	2	87002044	missense	probably damaging	0.97
R3925:Olfr1102	UTSW	2	87002374	missense	possibly damaging	0.91
R4023:Olfr1102	UTSW	2	87002922	nonsense	probably null
R4730:Olfr1102	UTSW	2	87002166	missense	possibly damaging	0.48
R5154:Olfr1102	UTSW	2	87002038	missense	probably benign	0.00
R5685:Olfr1102	UTSW	2	87002277	missense	probably benign	0.02
R5788:Olfr1102	UTSW	2	87002301	missense	probably benign	0.01
R6280:Olfr1102	UTSW	2	87002020	missense	probably damaging	0.99
R7178:Olfr1102	UTSW	2	87002535	missense	probably benign	0.07
Z1176:Olfr1102	UTSW	2	87002610	missense	probably benign	0.04
Z1176:Olfr1102	UTSW	2	87002611	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGATTCACGGCTCCACAAC -3'
(R):5'- TGGAGCCTGCACAGTAGAAG -3'

Sequencing Primer
(F):5'- ACAACCCCATGTACTATTTTCTGAC -3'
(R):5'- TTTCATTGGATCCACAGAAAGAAAGG -3'

Posted On

2016-10-05