Incidental Mutation 'R5525:Olfr1102'
ID431800
Institutional Source Beutler Lab
Gene Symbol Olfr1102
Ensembl Gene ENSMUSG00000049843
Gene Nameolfactory receptor 1102
SynonymsMOR179-4, GA_x6K02T2Q125-48487992-48488966
MMRRC Submission 043083-MU
Accession Numbers

Ncbi RefSeq: NM_207154.2; MGI: 3030936

Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86998398-87003618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87002339 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 123 (E123D)
Ref Sequence ENSEMBL: ENSMUSP00000149634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055129] [ENSMUST00000214002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055129
AA Change: E123D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052861
Gene: ENSMUSG00000049843
AA Change: E123D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:7tm_4 43 320 8.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 47 322 8.7e-6 PFAM
Pfam:7tm_1 53 302 3.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214002
AA Change: E123D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Olfr1102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1102 APN 2 87002923 missense probably benign 0.31
IGL01584:Olfr1102 APN 2 87002151 missense probably benign 0.04
IGL01913:Olfr1102 APN 2 87002820 missense possibly damaging 0.68
IGL02672:Olfr1102 APN 2 87002073 missense probably benign 0.00
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R0003:Olfr1102 UTSW 2 87002366 nonsense probably null
R1674:Olfr1102 UTSW 2 87002233 missense probably benign 0.07
R1688:Olfr1102 UTSW 2 87002386 missense probably benign 0.01
R3826:Olfr1102 UTSW 2 87002044 missense probably damaging 0.97
R3925:Olfr1102 UTSW 2 87002374 missense possibly damaging 0.91
R4023:Olfr1102 UTSW 2 87002922 nonsense probably null
R4730:Olfr1102 UTSW 2 87002166 missense possibly damaging 0.48
R5154:Olfr1102 UTSW 2 87002038 missense probably benign 0.00
R5685:Olfr1102 UTSW 2 87002277 missense probably benign 0.02
R5788:Olfr1102 UTSW 2 87002301 missense probably benign 0.01
R6280:Olfr1102 UTSW 2 87002020 missense probably damaging 0.99
R7178:Olfr1102 UTSW 2 87002535 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGGATTCACGGCTCCACAAC -3'
(R):5'- TGGAGCCTGCACAGTAGAAG -3'

Sequencing Primer
(F):5'- ACAACCCCATGTACTATTTTCTGAC -3'
(R):5'- TTTCATTGGATCCACAGAAAGAAAGG -3'
Posted On2016-10-05