Incidental Mutation 'R5525:Grm3'
ID431807
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Nameglutamate receptor, metabotropic 3
SynonymsGprc1c, mGlu3, mGluR3, 0710001G23Rik
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location9485541-9725170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9504872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 807 (V807I)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
Predicted Effect probably damaging
Transcript: ENSMUST00000004076
AA Change: V807I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: V807I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9512290 missense probably benign
IGL01393:Grm3 APN 5 9589856 missense probably benign 0.00
IGL01398:Grm3 APN 5 9485762 unclassified probably benign
IGL01825:Grm3 APN 5 9511600 missense probably damaging 1.00
IGL01966:Grm3 APN 5 9511486 missense probably damaging 0.98
IGL02367:Grm3 APN 5 9511660 missense probably damaging 1.00
IGL02526:Grm3 APN 5 9589847 missense probably damaging 1.00
IGL02972:Grm3 APN 5 9512410 missense probably damaging 1.00
IGL03356:Grm3 APN 5 9512206 missense possibly damaging 0.89
BB002:Grm3 UTSW 5 9589880 missense probably benign 0.09
BB012:Grm3 UTSW 5 9589880 missense probably benign 0.09
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0389:Grm3 UTSW 5 9504794 missense probably damaging 1.00
R0455:Grm3 UTSW 5 9512477 missense probably benign
R0538:Grm3 UTSW 5 9512446 missense possibly damaging 0.95
R0553:Grm3 UTSW 5 9570048 missense probably benign 0.16
R1124:Grm3 UTSW 5 9570297 missense probably benign
R1163:Grm3 UTSW 5 9570738 missense probably benign 0.34
R1440:Grm3 UTSW 5 9589958 missense probably benign
R1635:Grm3 UTSW 5 9511520 missense probably damaging 1.00
R1734:Grm3 UTSW 5 9589742 missense probably benign 0.00
R1895:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R1926:Grm3 UTSW 5 9504881 missense probably damaging 0.98
R1940:Grm3 UTSW 5 9511682 missense probably damaging 1.00
R1946:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R2004:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R3116:Grm3 UTSW 5 9570752 missense probably damaging 1.00
R4083:Grm3 UTSW 5 9512054 missense probably benign
R4537:Grm3 UTSW 5 9512083 missense probably benign 0.02
R4855:Grm3 UTSW 5 9570047 missense probably damaging 0.98
R5060:Grm3 UTSW 5 9570167 missense probably damaging 0.99
R5093:Grm3 UTSW 5 9589766 missense probably benign 0.01
R5419:Grm3 UTSW 5 9570233 missense probably damaging 1.00
R5642:Grm3 UTSW 5 9570536 missense probably benign 0.21
R5804:Grm3 UTSW 5 9570155 missense probably benign 0.33
R5915:Grm3 UTSW 5 9511927 missense probably damaging 1.00
R5966:Grm3 UTSW 5 9511930 missense probably damaging 0.98
R6151:Grm3 UTSW 5 9511556 missense probably damaging 1.00
R6419:Grm3 UTSW 5 9570201 missense probably damaging 1.00
R7267:Grm3 UTSW 5 9589581 missense probably benign 0.00
R7555:Grm3 UTSW 5 9570000 missense probably benign 0.00
R7657:Grm3 UTSW 5 9511452 splice site probably null
R7925:Grm3 UTSW 5 9589880 missense probably benign 0.09
R8032:Grm3 UTSW 5 9512272 missense probably benign 0.11
R8227:Grm3 UTSW 5 9570242 missense possibly damaging 0.65
X0020:Grm3 UTSW 5 9512195 missense probably damaging 1.00
X0025:Grm3 UTSW 5 9485790 missense probably damaging 1.00
X0026:Grm3 UTSW 5 9512238 nonsense probably null
Z1088:Grm3 UTSW 5 9570183 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTGGTGCTATTGACGAATGAATC -3'
(R):5'- CCCACACAAATGATGCTTGC -3'

Sequencing Primer
(F):5'- ACCACATTCTTCTGGGGT -3'
(R):5'- CACAAATGATGCTTGCTTTGAAATCC -3'
Posted On2016-10-05