Incidental Mutation 'R5525:Sdk1'
ID 431808
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Name sidekick cell adhesion molecule 1
Synonyms 6720466O15Rik
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 141241490-142215586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142185265 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1961 (V1961A)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
AlphaFold Q3UH53
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: V1701A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: V1701A

IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085774
AA Change: V1961A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: V1961A

low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0149:Sdk1 UTSW 5 141857054 intron probably benign
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 splice site probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
R7985:Sdk1 UTSW 5 142127847 missense probably damaging 1.00
R8129:Sdk1 UTSW 5 142191893 missense probably benign 0.10
R8217:Sdk1 UTSW 5 142211958 missense possibly damaging 0.81
R8249:Sdk1 UTSW 5 142188015 critical splice acceptor site probably null
R8376:Sdk1 UTSW 5 142158621 missense possibly damaging 0.83
R8779:Sdk1 UTSW 5 141962702 missense probably benign 0.00
R8807:Sdk1 UTSW 5 142085627 missense probably damaging 1.00
R8907:Sdk1 UTSW 5 142084523 missense probably damaging 0.99
R8942:Sdk1 UTSW 5 142096843 missense probably damaging 1.00
R8945:Sdk1 UTSW 5 141613180 missense probably benign
R9006:Sdk1 UTSW 5 141937566 missense probably damaging 1.00
R9249:Sdk1 UTSW 5 142143795 missense probably damaging 1.00
R9275:Sdk1 UTSW 5 141956198 missense possibly damaging 0.95
R9345:Sdk1 UTSW 5 142161953 missense probably benign
R9463:Sdk1 UTSW 5 141962793 missense probably benign 0.31
R9549:Sdk1 UTSW 5 141954902 missense possibly damaging 0.95
R9572:Sdk1 UTSW 5 141610029 missense probably damaging 1.00
R9602:Sdk1 UTSW 5 142085598 missense probably damaging 0.99
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141959310 missense probably null 0.58
Z1177:Sdk1 UTSW 5 141962708 missense possibly damaging 0.87
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-10-05