Incidental Mutation 'R5525:Sdk1'
ID 431808
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Name sidekick cell adhesion molecule 1
Synonyms 6720466O15Rik
MMRRC Submission 043083-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 141227245-142201341 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142171020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1961 (V1961A)
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
AlphaFold Q3UH53
Predicted Effect probably benign
Transcript: ENSMUST00000074546
AA Change: V1701A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: V1701A

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085774
AA Change: V1961A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: V1961A

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,749,731 (GRCm39) T1501A probably benign Het
Acin1 G A 14: 54,901,848 (GRCm39) A648V possibly damaging Het
Agap1 A G 1: 89,671,495 (GRCm39) T401A possibly damaging Het
Anapc4 T G 5: 53,014,151 (GRCm39) M440R probably damaging Het
Ankrd26 A G 6: 118,504,692 (GRCm39) M739T probably benign Het
Brip1 T C 11: 86,001,273 (GRCm39) E721G possibly damaging Het
Bzw1 A G 1: 58,442,065 (GRCm39) E221G possibly damaging Het
Cenpm A C 15: 82,123,492 (GRCm39) probably null Het
Exosc1 T A 19: 41,912,457 (GRCm39) K143N probably damaging Het
Fgd5 T A 6: 92,043,228 (GRCm39) L1236Q probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Grm3 C T 5: 9,554,872 (GRCm39) V807I probably damaging Het
Kndc1 A G 7: 139,504,026 (GRCm39) N1110S probably benign Het
Magi1 A T 6: 93,769,354 (GRCm39) V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 (GRCm39) M5298R possibly damaging Het
Nlrp9c T A 7: 26,083,926 (GRCm39) E551V probably damaging Het
Oacyl A C 18: 65,878,427 (GRCm39) I457L probably benign Het
Or12d13 C T 17: 37,647,517 (GRCm39) G202D probably damaging Het
Or5p69 A G 7: 107,967,206 (GRCm39) I170V probably benign Het
Or5t17 A T 2: 86,832,683 (GRCm39) E123D possibly damaging Het
Rab11fip3 T C 17: 26,210,269 (GRCm39) E996G probably damaging Het
Rabep1 T A 11: 70,813,972 (GRCm39) S554T probably damaging Het
Rln1 T C 19: 29,311,920 (GRCm39) E26G probably benign Het
Rpf1 A G 3: 146,223,559 (GRCm39) silent Het
Serpinb8 A T 1: 107,535,023 (GRCm39) I365F probably damaging Het
Shank2 A G 7: 143,623,846 (GRCm39) D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,259,538 (GRCm39) probably benign Het
Thsd7a T C 6: 12,332,006 (GRCm39) T1269A possibly damaging Het
Ttll3 A G 6: 113,389,939 (GRCm39) N776D probably benign Het
Unc80 A G 1: 66,645,773 (GRCm39) E1483G possibly damaging Het
Ush2a A G 1: 188,485,803 (GRCm39) D2971G probably benign Het
Zfp322a A G 13: 23,541,685 (GRCm39) V19A probably benign Het
Zfp462 C A 4: 55,050,281 (GRCm39) P2164T possibly damaging Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142,071,361 (GRCm39) missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142,070,368 (GRCm39) critical splice donor site probably null
IGL00946:Sdk1 APN 5 142,070,368 (GRCm39) critical splice donor site probably null
IGL01394:Sdk1 APN 5 141,598,970 (GRCm39) missense probably benign 0.03
IGL01398:Sdk1 APN 5 141,923,332 (GRCm39) missense probably benign 0.00
IGL01410:Sdk1 APN 5 142,197,875 (GRCm39) missense probably benign 0.30
IGL01525:Sdk1 APN 5 141,985,675 (GRCm39) missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142,071,520 (GRCm39) missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142,170,930 (GRCm39) missense probably benign 0.33
IGL01676:Sdk1 APN 5 142,113,591 (GRCm39) missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142,031,919 (GRCm39) missense probably benign
IGL01929:Sdk1 APN 5 141,938,785 (GRCm39) missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142,071,437 (GRCm39) missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142,020,184 (GRCm39) missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141,938,767 (GRCm39) missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141,938,771 (GRCm39) missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141,595,787 (GRCm39) missense probably benign 0.01
IGL02637:Sdk1 APN 5 142,080,327 (GRCm39) missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142,158,299 (GRCm39) missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142,071,497 (GRCm39) missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141,938,788 (GRCm39) nonsense probably null
PIT4453001:Sdk1 UTSW 5 142,197,793 (GRCm39) missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141,941,987 (GRCm39) missense probably benign 0.08
R0149:Sdk1 UTSW 5 141,842,809 (GRCm39) intron probably benign
R0173:Sdk1 UTSW 5 142,159,564 (GRCm39) splice site probably benign
R0240:Sdk1 UTSW 5 141,984,502 (GRCm39) missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141,984,502 (GRCm39) missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142,129,677 (GRCm39) splice site probably benign
R0245:Sdk1 UTSW 5 141,940,713 (GRCm39) missense probably benign 0.02
R0270:Sdk1 UTSW 5 142,070,321 (GRCm39) missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141,948,476 (GRCm39) missense probably benign 0.05
R0401:Sdk1 UTSW 5 142,031,916 (GRCm39) missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141,923,473 (GRCm39) missense probably benign
R0558:Sdk1 UTSW 5 142,117,820 (GRCm39) missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141,940,713 (GRCm39) missense probably benign 0.02
R0834:Sdk1 UTSW 5 141,227,779 (GRCm39) missense probably benign
R0962:Sdk1 UTSW 5 142,147,630 (GRCm39) missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142,147,621 (GRCm39) missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142,024,078 (GRCm39) missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142,113,591 (GRCm39) missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141,985,705 (GRCm39) missense probably benign 0.00
R1539:Sdk1 UTSW 5 142,080,354 (GRCm39) missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141,984,634 (GRCm39) missense probably benign 0.03
R1574:Sdk1 UTSW 5 141,984,634 (GRCm39) missense probably benign 0.03
R1673:Sdk1 UTSW 5 141,934,261 (GRCm39) missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142,020,292 (GRCm39) missense probably benign 0.00
R1806:Sdk1 UTSW 5 142,147,681 (GRCm39) missense probably benign
R1806:Sdk1 UTSW 5 141,598,950 (GRCm39) missense probably damaging 1.00
R1925:Sdk1 UTSW 5 142,171,040 (GRCm39) missense probably benign 0.09
R1956:Sdk1 UTSW 5 142,080,336 (GRCm39) missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142,129,573 (GRCm39) missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142,170,943 (GRCm39) missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141,778,699 (GRCm39) missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142,032,047 (GRCm39) missense probably benign 0.00
R2187:Sdk1 UTSW 5 142,100,329 (GRCm39) missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141,948,455 (GRCm39) missense probably benign 0.00
R2520:Sdk1 UTSW 5 142,071,526 (GRCm39) missense probably benign 0.19
R2698:Sdk1 UTSW 5 142,197,805 (GRCm39) missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142,070,306 (GRCm39) missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142,031,991 (GRCm39) missense probably benign
R3500:Sdk1 UTSW 5 141,992,371 (GRCm39) splice site probably benign
R3613:Sdk1 UTSW 5 142,105,441 (GRCm39) missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141,921,804 (GRCm39) missense probably benign
R3916:Sdk1 UTSW 5 142,036,999 (GRCm39) missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142,036,999 (GRCm39) missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142,100,154 (GRCm39) missense probably benign 0.00
R4160:Sdk1 UTSW 5 142,100,154 (GRCm39) missense probably benign 0.00
R4161:Sdk1 UTSW 5 142,100,154 (GRCm39) missense probably benign 0.00
R4386:Sdk1 UTSW 5 142,080,381 (GRCm39) missense probably damaging 0.99
R4649:Sdk1 UTSW 5 141,992,380 (GRCm39) missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142,170,986 (GRCm39) missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141,944,993 (GRCm39) missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141,568,168 (GRCm39) missense probably benign
R4825:Sdk1 UTSW 5 141,568,049 (GRCm39) missense probably benign 0.11
R4853:Sdk1 UTSW 5 142,132,018 (GRCm39) missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142,147,531 (GRCm39) missense probably benign 0.01
R4928:Sdk1 UTSW 5 141,842,758 (GRCm39) intron probably benign
R5111:Sdk1 UTSW 5 142,113,600 (GRCm39) missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141,942,015 (GRCm39) critical splice donor site probably null
R5246:Sdk1 UTSW 5 142,100,317 (GRCm39) missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141,984,583 (GRCm39) missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142,085,941 (GRCm39) missense probably damaging 1.00
R5578:Sdk1 UTSW 5 141,598,880 (GRCm39) nonsense probably null
R5593:Sdk1 UTSW 5 141,941,879 (GRCm39) missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141,921,853 (GRCm39) missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142,173,900 (GRCm39) missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142,129,626 (GRCm39) missense probably benign 0.00
R5781:Sdk1 UTSW 5 141,921,803 (GRCm39) missense probably benign 0.00
R5846:Sdk1 UTSW 5 142,100,148 (GRCm39) missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141,948,424 (GRCm39) missense probably benign 0.00
R6164:Sdk1 UTSW 5 142,117,824 (GRCm39) missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142,020,181 (GRCm39) missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141,948,464 (GRCm39) missense probably benign 0.00
R6453:Sdk1 UTSW 5 142,082,676 (GRCm39) missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142,032,053 (GRCm39) missense probably benign 0.00
R6996:Sdk1 UTSW 5 142,197,769 (GRCm39) missense probably benign 0.16
R7003:Sdk1 UTSW 5 142,082,489 (GRCm39) missense probably benign 0.01
R7022:Sdk1 UTSW 5 142,080,412 (GRCm39) splice site probably null
R7027:Sdk1 UTSW 5 142,082,481 (GRCm39) splice site probably null
R7098:Sdk1 UTSW 5 142,082,625 (GRCm39) missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142,067,471 (GRCm39) missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142,031,931 (GRCm39) missense probably benign 0.08
R7313:Sdk1 UTSW 5 141,923,377 (GRCm39) missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142,173,897 (GRCm39) missense probably benign 0.05
R7375:Sdk1 UTSW 5 141,984,598 (GRCm39) missense probably benign 0.01
R7446:Sdk1 UTSW 5 142,130,731 (GRCm39) missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141,778,731 (GRCm39) missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141,595,753 (GRCm39) nonsense probably null
R7747:Sdk1 UTSW 5 142,070,246 (GRCm39) missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141,923,434 (GRCm39) missense probably benign
R7985:Sdk1 UTSW 5 142,113,602 (GRCm39) missense probably damaging 1.00
R8129:Sdk1 UTSW 5 142,177,648 (GRCm39) missense probably benign 0.10
R8217:Sdk1 UTSW 5 142,197,713 (GRCm39) missense possibly damaging 0.81
R8249:Sdk1 UTSW 5 142,173,770 (GRCm39) critical splice acceptor site probably null
R8376:Sdk1 UTSW 5 142,144,376 (GRCm39) missense possibly damaging 0.83
R8779:Sdk1 UTSW 5 141,948,457 (GRCm39) missense probably benign 0.00
R8807:Sdk1 UTSW 5 142,071,382 (GRCm39) missense probably damaging 1.00
R8907:Sdk1 UTSW 5 142,070,278 (GRCm39) missense probably damaging 0.99
R8942:Sdk1 UTSW 5 142,082,598 (GRCm39) missense probably damaging 1.00
R8945:Sdk1 UTSW 5 141,598,935 (GRCm39) missense probably benign
R9006:Sdk1 UTSW 5 141,923,321 (GRCm39) missense probably damaging 1.00
R9249:Sdk1 UTSW 5 142,129,550 (GRCm39) missense probably damaging 1.00
R9275:Sdk1 UTSW 5 141,941,953 (GRCm39) missense possibly damaging 0.95
R9345:Sdk1 UTSW 5 142,147,708 (GRCm39) missense probably benign
R9463:Sdk1 UTSW 5 141,948,548 (GRCm39) missense probably benign 0.31
R9549:Sdk1 UTSW 5 141,940,657 (GRCm39) missense possibly damaging 0.95
R9572:Sdk1 UTSW 5 141,595,784 (GRCm39) missense probably damaging 1.00
R9602:Sdk1 UTSW 5 142,071,353 (GRCm39) missense probably damaging 0.99
R9703:Sdk1 UTSW 5 142,100,283 (GRCm39) missense possibly damaging 0.95
R9720:Sdk1 UTSW 5 142,197,796 (GRCm39) missense probably damaging 0.96
R9771:Sdk1 UTSW 5 142,082,624 (GRCm39) missense probably damaging 0.99
X0017:Sdk1 UTSW 5 141,984,535 (GRCm39) missense probably benign 0.00
Z1176:Sdk1 UTSW 5 141,945,065 (GRCm39) missense probably null 0.58
Z1177:Sdk1 UTSW 5 141,948,463 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAGATACCAAATATCCTATAACAGCT -3'
(R):5'- CCGTGTTCCCTACTGCGA -3'

Sequencing Primer
(F):5'- GCTATCTATATAAGAGTTGCCCTGAC -3'
(R):5'- GCGATCTGATCTGCAGCATC -3'
Posted On 2016-10-05