Incidental Mutation 'R5525:Fgd5'
ID431810
Institutional Source Beutler Lab
Gene Symbol Fgd5
Ensembl Gene ENSMUSG00000034037
Gene NameFYVE, RhoGEF and PH domain containing 5
SynonymsC330025N11Rik, ZFYVE23
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91978878-92076004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92066247 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1236 (L1236Q)
Ref Sequence ENSEMBL: ENSMUSP00000086748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]
Predicted Effect probably damaging
Transcript: ENSMUST00000089334
AA Change: L1236Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: L1236Q

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
internal_repeat_1 126 169 2.6e-7 PROSPERO
internal_repeat_1 164 198 2.6e-7 PROSPERO
low complexity region 201 222 N/A INTRINSIC
low complexity region 254 269 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 426 442 N/A INTRINSIC
low complexity region 453 475 N/A INTRINSIC
low complexity region 652 663 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
low complexity region 727 736 N/A INTRINSIC
low complexity region 879 894 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Pfam:RhoGEF 946 1134 2.2e-28 PFAM
PH 1165 1260 4.93e-13 SMART
FYVE 1285 1353 2.51e-16 SMART
low complexity region 1368 1390 N/A INTRINSIC
PH 1416 1514 2.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113466
AA Change: L1078Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: L1078Q

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
low complexity region 721 736 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
Pfam:RhoGEF 788 976 1.6e-27 PFAM
PH 1007 1102 4.93e-13 SMART
FYVE 1127 1195 2.51e-16 SMART
low complexity region 1210 1232 N/A INTRINSIC
PH 1258 1356 2.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146743
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Fgd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Fgd5 APN 6 91988459 missense possibly damaging 0.63
IGL01354:Fgd5 APN 6 92061843 nonsense probably null
IGL01597:Fgd5 APN 6 91987929 missense probably damaging 1.00
IGL01648:Fgd5 APN 6 91989359 nonsense probably null
IGL01781:Fgd5 APN 6 91988717 missense possibly damaging 0.88
IGL01977:Fgd5 APN 6 92024562 missense probably benign 0.20
IGL02053:Fgd5 APN 6 92053244 missense probably benign 0.03
IGL02206:Fgd5 APN 6 91987258 utr 5 prime probably benign
IGL02825:Fgd5 APN 6 92038087 splice site probably null
IGL02838:Fgd5 APN 6 91987674 missense probably benign
IGL03126:Fgd5 APN 6 92065164 missense probably damaging 1.00
IGL03369:Fgd5 APN 6 91988415 missense probably damaging 1.00
hygeia UTSW 6 91989300 missense probably damaging 1.00
Imploded UTSW 6 92049931 intron probably null
R0029:Fgd5 UTSW 6 92067558 missense probably benign 0.04
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0212:Fgd5 UTSW 6 91988208 missense probably damaging 1.00
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1159:Fgd5 UTSW 6 91988502 missense probably benign 0.00
R1199:Fgd5 UTSW 6 91986978 missense possibly damaging 0.87
R1493:Fgd5 UTSW 6 91987631 missense probably benign
R1602:Fgd5 UTSW 6 92066184 missense possibly damaging 0.95
R1953:Fgd5 UTSW 6 92024630 missense probably benign 0.31
R2280:Fgd5 UTSW 6 91988945 missense possibly damaging 0.86
R2437:Fgd5 UTSW 6 92062869 nonsense probably null
R2883:Fgd5 UTSW 6 91987109 unclassified probably null
R4133:Fgd5 UTSW 6 92069437 missense probably damaging 1.00
R4454:Fgd5 UTSW 6 91989186 missense probably damaging 1.00
R4491:Fgd5 UTSW 6 91989299 missense possibly damaging 0.90
R4606:Fgd5 UTSW 6 91988209 missense possibly damaging 0.67
R4981:Fgd5 UTSW 6 91989300 missense probably damaging 1.00
R5162:Fgd5 UTSW 6 92074234 missense probably damaging 1.00
R5570:Fgd5 UTSW 6 91988687 missense probably damaging 1.00
R5936:Fgd5 UTSW 6 91987911 missense probably damaging 0.98
R6012:Fgd5 UTSW 6 91989341 missense possibly damaging 0.95
R6723:Fgd5 UTSW 6 91988030 missense probably benign
R6764:Fgd5 UTSW 6 91989421 missense probably damaging 0.96
R7187:Fgd5 UTSW 6 91988291 missense possibly damaging 0.54
R7383:Fgd5 UTSW 6 91987118 missense probably benign 0.01
R7418:Fgd5 UTSW 6 92024538 missense probably benign 0.11
R7662:Fgd5 UTSW 6 92049931 intron probably null
R7788:Fgd5 UTSW 6 91988459 missense possibly damaging 0.63
R7882:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7895:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R7965:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7978:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R8041:Fgd5 UTSW 6 92061856 missense probably damaging 0.98
R8053:Fgd5 UTSW 6 91989444 missense probably benign 0.34
R8176:Fgd5 UTSW 6 91987984 missense probably benign 0.13
R8243:Fgd5 UTSW 6 91989023 missense possibly damaging 0.93
R8318:Fgd5 UTSW 6 91987496 missense probably benign 0.17
X0064:Fgd5 UTSW 6 92050040 missense probably benign 0.02
Z1176:Fgd5 UTSW 6 91988889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGTCAGAACCCTGTC -3'
(R):5'- TTTCATGGGGCCTACAGACCTC -3'

Sequencing Primer
(F):5'- GTCAGAACCCTGTCCAGCC -3'
(R):5'- CTGAACCAGGGCCTTAGTATGTCAG -3'
Posted On2016-10-05