Incidental Mutation 'R5525:Ttll3'
ID 431812
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 113389260-113414587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113412978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 776 (N776D)
Ref Sequence ENSEMBL: ENSMUSP00000037870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000060634] [ENSMUST00000113092] [ENSMUST00000129047] [ENSMUST00000129560] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect probably benign
Transcript: ENSMUST00000032414
AA Change: N775D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: N775D

low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038889
AA Change: N776D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: N776D

low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060634
SMART Domains Protein: ENSMUSP00000059057
Gene: ENSMUSG00000051169

Pfam:PseudoU_synth_2 82 236 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113092
SMART Domains Protein: ENSMUSP00000108715
Gene: ENSMUSG00000051169

Pfam:PseudoU_synth_2 82 246 7.4e-20 PFAM
low complexity region 303 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124368
AA Change: K17R
Predicted Effect probably benign
Transcript: ENSMUST00000129047
SMART Domains Protein: ENSMUSP00000120380
Gene: ENSMUSG00000051169

Pfam:PseudoU_synth_2 82 246 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134853
Predicted Effect probably benign
Transcript: ENSMUST00000147726
SMART Domains Protein: ENSMUSP00000120250
Gene: ENSMUSG00000051169

Pfam:PseudoU_synth_2 71 235 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151618
SMART Domains Protein: ENSMUSP00000115950
Gene: ENSMUSG00000051169

Pfam:PseudoU_synth_2 72 179 5.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161831
AA Change: K579R
Predicted Effect unknown
Transcript: ENSMUST00000203524
AA Change: N622D
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204498
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113412889 missense probably benign 0.00
R9036:Ttll3 UTSW 6 113399696 missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113392635 missense probably benign
R9271:Ttll3 UTSW 6 113392635 missense probably benign
R9329:Ttll3 UTSW 6 113392674 missense probably benign
R9532:Ttll3 UTSW 6 113409009 missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113412873 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-10-05