Incidental Mutation 'R5525:Nlrp9c'
ID431814
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26384501 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 551 (E551V)
Ref Sequence ENSEMBL: ENSMUSP00000083106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect probably damaging
Transcript: ENSMUST00000041845
AA Change: E551V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: E551V

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085944
AA Change: E551V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: E551V

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160948
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACAAGGCTTAGAGACATACTC -3'
(R):5'- TGGAATTGCCACTAAACATGTG -3'

Sequencing Primer
(F):5'- GAGACATACTCACTTTTGGTCCAG -3'
(R):5'- GCCACTAAACATGTGATCACTTTGC -3'
Posted On2016-10-05