Incidental Mutation 'R5525:Or5p69'
ID 431818
Institutional Source Beutler Lab
Gene Symbol Or5p69
Ensembl Gene ENSMUSG00000109631
Gene Name olfactory receptor family 5 subfamily P member 69
Synonyms GA_x6K02T2PBJ9-10697517-10698461, MOR204-10, Olfr494
MMRRC Submission 043083-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 107966699-107967643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107967206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 170 (I170V)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
AlphaFold Q8VG07
Predicted Effect probably benign
Transcript: ENSMUST00000073059
AA Change: I170V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: I170V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209743
AA Change: I170V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210291
AA Change: I170V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,749,731 (GRCm39) T1501A probably benign Het
Acin1 G A 14: 54,901,848 (GRCm39) A648V possibly damaging Het
Agap1 A G 1: 89,671,495 (GRCm39) T401A possibly damaging Het
Anapc4 T G 5: 53,014,151 (GRCm39) M440R probably damaging Het
Ankrd26 A G 6: 118,504,692 (GRCm39) M739T probably benign Het
Brip1 T C 11: 86,001,273 (GRCm39) E721G possibly damaging Het
Bzw1 A G 1: 58,442,065 (GRCm39) E221G possibly damaging Het
Cenpm A C 15: 82,123,492 (GRCm39) probably null Het
Exosc1 T A 19: 41,912,457 (GRCm39) K143N probably damaging Het
Fgd5 T A 6: 92,043,228 (GRCm39) L1236Q probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Grm3 C T 5: 9,554,872 (GRCm39) V807I probably damaging Het
Kndc1 A G 7: 139,504,026 (GRCm39) N1110S probably benign Het
Magi1 A T 6: 93,769,354 (GRCm39) V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 (GRCm39) M5298R possibly damaging Het
Nlrp9c T A 7: 26,083,926 (GRCm39) E551V probably damaging Het
Oacyl A C 18: 65,878,427 (GRCm39) I457L probably benign Het
Or12d13 C T 17: 37,647,517 (GRCm39) G202D probably damaging Het
Or5t17 A T 2: 86,832,683 (GRCm39) E123D possibly damaging Het
Rab11fip3 T C 17: 26,210,269 (GRCm39) E996G probably damaging Het
Rabep1 T A 11: 70,813,972 (GRCm39) S554T probably damaging Het
Rln1 T C 19: 29,311,920 (GRCm39) E26G probably benign Het
Rpf1 A G 3: 146,223,559 (GRCm39) silent Het
Sdk1 T C 5: 142,171,020 (GRCm39) V1961A possibly damaging Het
Serpinb8 A T 1: 107,535,023 (GRCm39) I365F probably damaging Het
Shank2 A G 7: 143,623,846 (GRCm39) D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,259,538 (GRCm39) probably benign Het
Thsd7a T C 6: 12,332,006 (GRCm39) T1269A possibly damaging Het
Ttll3 A G 6: 113,389,939 (GRCm39) N776D probably benign Het
Unc80 A G 1: 66,645,773 (GRCm39) E1483G possibly damaging Het
Ush2a A G 1: 188,485,803 (GRCm39) D2971G probably benign Het
Zfp322a A G 13: 23,541,685 (GRCm39) V19A probably benign Het
Zfp462 C A 4: 55,050,281 (GRCm39) P2164T possibly damaging Het
Other mutations in Or5p69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Or5p69 APN 7 107,967,525 (GRCm39) missense probably damaging 1.00
IGL01934:Or5p69 APN 7 107,967,368 (GRCm39) missense probably damaging 0.99
IGL02041:Or5p69 APN 7 107,966,742 (GRCm39) missense probably damaging 1.00
IGL02253:Or5p69 APN 7 107,967,261 (GRCm39) missense possibly damaging 0.80
IGL02902:Or5p69 APN 7 107,967,336 (GRCm39) missense probably damaging 1.00
R0125:Or5p69 UTSW 7 107,967,576 (GRCm39) missense probably damaging 0.98
R0523:Or5p69 UTSW 7 107,967,438 (GRCm39) missense probably damaging 1.00
R0650:Or5p69 UTSW 7 107,966,996 (GRCm39) missense probably damaging 1.00
R1268:Or5p69 UTSW 7 107,967,002 (GRCm39) missense probably benign 0.06
R2036:Or5p69 UTSW 7 107,966,947 (GRCm39) missense probably benign 0.00
R2162:Or5p69 UTSW 7 107,966,769 (GRCm39) missense probably benign 0.08
R2278:Or5p69 UTSW 7 107,967,288 (GRCm39) missense probably benign 0.01
R2368:Or5p69 UTSW 7 107,967,576 (GRCm39) missense probably damaging 0.98
R3410:Or5p69 UTSW 7 107,967,551 (GRCm39) missense possibly damaging 0.52
R3411:Or5p69 UTSW 7 107,967,551 (GRCm39) missense possibly damaging 0.52
R3834:Or5p69 UTSW 7 107,967,279 (GRCm39) missense probably damaging 0.98
R4322:Or5p69 UTSW 7 107,967,555 (GRCm39) missense probably damaging 1.00
R4625:Or5p69 UTSW 7 107,966,895 (GRCm39) missense probably damaging 0.98
R4724:Or5p69 UTSW 7 107,967,205 (GRCm39) missense probably benign
R4843:Or5p69 UTSW 7 107,967,350 (GRCm39) missense probably benign 0.01
R5954:Or5p69 UTSW 7 107,966,808 (GRCm39) missense probably damaging 0.98
R7027:Or5p69 UTSW 7 107,967,557 (GRCm39) missense probably damaging 0.98
R8041:Or5p69 UTSW 7 107,966,741 (GRCm39) missense probably damaging 1.00
R8237:Or5p69 UTSW 7 107,967,234 (GRCm39) missense probably damaging 1.00
R9566:Or5p69 UTSW 7 107,966,783 (GRCm39) missense probably benign 0.01
Z1177:Or5p69 UTSW 7 107,967,468 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACAGTTGAATGCTTTCTTC -3'
(R):5'- TGCAGGTAGAGAAGGCCTTG -3'

Sequencing Primer
(F):5'- CTGGCTGCCATGGCTTATGATC -3'
(R):5'- CCTCAGTGGAGTGCATCTTCAG -3'
Posted On 2016-10-05